ID: 984386117

View in Genome Browser
Species Human (GRCh38)
Location 4:179060055-179060077
Sequence GGCCCTGGATCCACAGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984386117_984386121 -7 Left 984386117 4:179060055-179060077 CCTATAACTGTGGATCCAGGGCC No data
Right 984386121 4:179060071-179060093 CAGGGCCCAGGATCTATGCTGGG No data
984386117_984386124 1 Left 984386117 4:179060055-179060077 CCTATAACTGTGGATCCAGGGCC No data
Right 984386124 4:179060079-179060101 AGGATCTATGCTGGGCCCTTTGG No data
984386117_984386120 -8 Left 984386117 4:179060055-179060077 CCTATAACTGTGGATCCAGGGCC No data
Right 984386120 4:179060070-179060092 CCAGGGCCCAGGATCTATGCTGG No data
984386117_984386125 8 Left 984386117 4:179060055-179060077 CCTATAACTGTGGATCCAGGGCC No data
Right 984386125 4:179060086-179060108 ATGCTGGGCCCTTTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984386117 Original CRISPR GGCCCTGGATCCACAGTTAT AGG (reversed) Intergenic
No off target data available for this crispr