ID: 984396437

View in Genome Browser
Species Human (GRCh38)
Location 4:179207376-179207398
Sequence CTAAAACATATTTAGATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984396437_984396439 6 Left 984396437 4:179207376-179207398 CCATGAATCTAAATATGTTTTAG No data
Right 984396439 4:179207405-179207427 TAACTAGACCAGTAAGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984396437 Original CRISPR CTAAAACATATTTAGATTCA TGG (reversed) Intergenic
No off target data available for this crispr