ID: 984400701

View in Genome Browser
Species Human (GRCh38)
Location 4:179260511-179260533
Sequence GTGCCCAACCAGATTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984400701_984400705 8 Left 984400701 4:179260511-179260533 CCACTCTCAATCTGGTTGGGCAC No data
Right 984400705 4:179260542-179260564 CAGATGCCAGCATGGCAGGAAGG No data
984400701_984400704 4 Left 984400701 4:179260511-179260533 CCACTCTCAATCTGGTTGGGCAC No data
Right 984400704 4:179260538-179260560 TAATCAGATGCCAGCATGGCAGG No data
984400701_984400703 0 Left 984400701 4:179260511-179260533 CCACTCTCAATCTGGTTGGGCAC No data
Right 984400703 4:179260534-179260556 CATCTAATCAGATGCCAGCATGG 0: 4
1: 269
2: 481
3: 616
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984400701 Original CRISPR GTGCCCAACCAGATTGAGAG TGG (reversed) Intergenic
No off target data available for this crispr