ID: 984404230

View in Genome Browser
Species Human (GRCh38)
Location 4:179306631-179306653
Sequence GAGCCGATGCTGCTTCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984404225_984404230 16 Left 984404225 4:179306592-179306614 CCTCTGAGCAGACAAAACACAAG No data
Right 984404230 4:179306631-179306653 GAGCCGATGCTGCTTCTCTTAGG No data
984404224_984404230 17 Left 984404224 4:179306591-179306613 CCCTCTGAGCAGACAAAACACAA No data
Right 984404230 4:179306631-179306653 GAGCCGATGCTGCTTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984404230 Original CRISPR GAGCCGATGCTGCTTCTCTT AGG Intergenic
No off target data available for this crispr