ID: 984405749

View in Genome Browser
Species Human (GRCh38)
Location 4:179327660-179327682
Sequence TCCTGTAGCAACAGAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984405747_984405749 30 Left 984405747 4:179327607-179327629 CCTAATTGTCCAACAGTTTTATT No data
Right 984405749 4:179327660-179327682 TCCTGTAGCAACAGAGCCTGAGG No data
984405748_984405749 21 Left 984405748 4:179327616-179327638 CCAACAGTTTTATTTAGTAATAC No data
Right 984405749 4:179327660-179327682 TCCTGTAGCAACAGAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984405749 Original CRISPR TCCTGTAGCAACAGAGCCTG AGG Intergenic
No off target data available for this crispr