ID: 984406339

View in Genome Browser
Species Human (GRCh38)
Location 4:179336399-179336421
Sequence TAATCTCCATGGTTTGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984406339_984406341 13 Left 984406339 4:179336399-179336421 CCATCAACAAACCATGGAGATTA No data
Right 984406341 4:179336435-179336457 TCATACATACTTAAAATATAAGG No data
984406339_984406342 17 Left 984406339 4:179336399-179336421 CCATCAACAAACCATGGAGATTA No data
Right 984406342 4:179336439-179336461 ACATACTTAAAATATAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984406339 Original CRISPR TAATCTCCATGGTTTGTTGA TGG (reversed) Intergenic