ID: 984406339 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:179336399-179336421 |
| Sequence | TAATCTCCATGGTTTGTTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984406339_984406341 | 13 | Left | 984406339 | 4:179336399-179336421 | CCATCAACAAACCATGGAGATTA | No data | ||
| Right | 984406341 | 4:179336435-179336457 | TCATACATACTTAAAATATAAGG | No data | ||||
| 984406339_984406342 | 17 | Left | 984406339 | 4:179336399-179336421 | CCATCAACAAACCATGGAGATTA | No data | ||
| Right | 984406342 | 4:179336439-179336461 | ACATACTTAAAATATAAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984406339 | Original CRISPR | TAATCTCCATGGTTTGTTGA TGG (reversed) | Intergenic | ||