ID: 984406339 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:179336399-179336421 |
Sequence | TAATCTCCATGGTTTGTTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
984406339_984406341 | 13 | Left | 984406339 | 4:179336399-179336421 | CCATCAACAAACCATGGAGATTA | No data | ||
Right | 984406341 | 4:179336435-179336457 | TCATACATACTTAAAATATAAGG | No data | ||||
984406339_984406342 | 17 | Left | 984406339 | 4:179336399-179336421 | CCATCAACAAACCATGGAGATTA | No data | ||
Right | 984406342 | 4:179336439-179336461 | ACATACTTAAAATATAAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
984406339 | Original CRISPR | TAATCTCCATGGTTTGTTGA TGG (reversed) | Intergenic | ||