ID: 984408219

View in Genome Browser
Species Human (GRCh38)
Location 4:179362099-179362121
Sequence CTTATCAGGTCACAGGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984408219_984408226 10 Left 984408219 4:179362099-179362121 CCCATCACCTGTGACCTGATAAG No data
Right 984408226 4:179362132-179362154 CAGTCCATAATCTCCGGCTTGGG No data
984408219_984408224 4 Left 984408219 4:179362099-179362121 CCCATCACCTGTGACCTGATAAG No data
Right 984408224 4:179362126-179362148 CATCGGCAGTCCATAATCTCCGG No data
984408219_984408225 9 Left 984408219 4:179362099-179362121 CCCATCACCTGTGACCTGATAAG No data
Right 984408225 4:179362131-179362153 GCAGTCCATAATCTCCGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984408219 Original CRISPR CTTATCAGGTCACAGGTGAT GGG (reversed) Intergenic
No off target data available for this crispr