ID: 984418141

View in Genome Browser
Species Human (GRCh38)
Location 4:179486776-179486798
Sequence ACTCAGTAGCAGCTTTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984418138_984418141 23 Left 984418138 4:179486730-179486752 CCTTTTCAGGGGCTCAGTGTTTG No data
Right 984418141 4:179486776-179486798 ACTCAGTAGCAGCTTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984418141 Original CRISPR ACTCAGTAGCAGCTTTAGCC AGG Intergenic
No off target data available for this crispr