ID: 984427772

View in Genome Browser
Species Human (GRCh38)
Location 4:179609536-179609558
Sequence CTGTATTTTCAGTTGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347026
Summary {0: 2, 1: 90, 2: 5492, 3: 114690, 4: 226752}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984427772_984427775 -6 Left 984427772 4:179609536-179609558 CCTCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 984427775 4:179609553-179609575 ATACAGAAGTTAGCCGGGTGTGG No data
984427772_984427779 17 Left 984427772 4:179609536-179609558 CCTCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 984427779 4:179609576-179609598 TGGCAGGCACCTGTACTCCCAGG No data
984427772_984427782 28 Left 984427772 4:179609536-179609558 CCTCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 984427782 4:179609587-179609609 TGTACTCCCAGGTACTTGGAAGG No data
984427772_984427780 24 Left 984427772 4:179609536-179609558 CCTCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 984427780 4:179609583-179609605 CACCTGTACTCCCAGGTACTTGG 0: 13
1: 1297
2: 59827
3: 127112
4: 175755
984427772_984427777 1 Left 984427772 4:179609536-179609558 CCTCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 984427777 4:179609560-179609582 AGTTAGCCGGGTGTGGTGGCAGG 0: 100
1: 5947
2: 36357
3: 77078
4: 78121
984427772_984427776 -3 Left 984427772 4:179609536-179609558 CCTCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 984427776 4:179609556-179609578 CAGAAGTTAGCCGGGTGTGGTGG 0: 7
1: 293
2: 9509
3: 64399
4: 152792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984427772 Original CRISPR CTGTATTTTCAGTTGAGACG AGG (reversed) Intergenic
Too many off-targets to display for this crispr