ID: 984428261

View in Genome Browser
Species Human (GRCh38)
Location 4:179615358-179615380
Sequence GGAGATACTGAGATAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984428258_984428261 4 Left 984428258 4:179615331-179615353 CCTGAATGTAGTTAGGAGGCCAG No data
Right 984428261 4:179615358-179615380 GGAGATACTGAGATAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984428261 Original CRISPR GGAGATACTGAGATAGAATC TGG Intergenic
No off target data available for this crispr