ID: 984430895

View in Genome Browser
Species Human (GRCh38)
Location 4:179647672-179647694
Sequence CAGTATGTTTAAATAAGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984430892_984430895 -6 Left 984430892 4:179647655-179647677 CCCAGATTCCATCATAGCAGTAT No data
Right 984430895 4:179647672-179647694 CAGTATGTTTAAATAAGTCGTGG No data
984430893_984430895 -7 Left 984430893 4:179647656-179647678 CCAGATTCCATCATAGCAGTATG No data
Right 984430895 4:179647672-179647694 CAGTATGTTTAAATAAGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984430895 Original CRISPR CAGTATGTTTAAATAAGTCG TGG Intergenic
No off target data available for this crispr