ID: 984432538

View in Genome Browser
Species Human (GRCh38)
Location 4:179666610-179666632
Sequence CCTTAGTTCAGCTAAAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 32, 1: 85, 2: 132, 3: 176, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984432538_984432542 9 Left 984432538 4:179666610-179666632 CCCTGTCTTTAGCTGAACTAAGG 0: 32
1: 85
2: 132
3: 176
4: 236
Right 984432542 4:179666642-179666664 GCAACAATGATACACCTTAAAGG No data
984432538_984432543 16 Left 984432538 4:179666610-179666632 CCCTGTCTTTAGCTGAACTAAGG 0: 32
1: 85
2: 132
3: 176
4: 236
Right 984432543 4:179666649-179666671 TGATACACCTTAAAGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984432538 Original CRISPR CCTTAGTTCAGCTAAAGACA GGG (reversed) Intergenic
900727670 1:4228448-4228470 CCTTAGTTCAACTAAAAAATGGG - Intergenic
900754560 1:4424728-4424750 CCTTAGCTCAGCTAATGACGGGG - Intergenic
900891384 1:5452048-5452070 CCTTAGTTCAGGTAAAAGCCAGG - Intergenic
903165568 1:21518056-21518078 GCTTAGTTCCTCCAAAGACAAGG - Intronic
904230265 1:29064204-29064226 ACTTAGTACAGCTCAAAACAGGG - Intronic
906935491 1:50210875-50210897 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
907379875 1:54077929-54077951 CCTCAGTTAAGCTGGAGACATGG - Intronic
907845644 1:58204008-58204030 CCTTAGTTCAGTTAGATACATGG - Intronic
908621700 1:65988464-65988486 CCTTCCTTCAGTCAAAGACAAGG - Intronic
909150397 1:71995253-71995275 ATTGAGTTGAGCTAAAGACAAGG - Intronic
909317702 1:74245333-74245355 TCTTTGTTCAGACAAAGACAAGG - Intronic
909601259 1:77464095-77464117 GCTTAGTTCAGCTGAAGACAGGG + Intronic
909736242 1:78966397-78966419 CCTTAGTTCAGCTAAGAGCCAGG - Intronic
909771617 1:79430371-79430393 CCTTAGTTCAGCTAAAATTCAGG + Intergenic
910131886 1:83917202-83917224 TGTTAGGTCAGCAAAAGACAGGG + Intronic
910419875 1:87047262-87047284 CCTTAGTTCATTTAAAAAAATGG + Intronic
910607236 1:89100348-89100370 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
911265054 1:95733676-95733698 CCTTCGTTTGGCTAAAAACAGGG + Intergenic
912080902 1:105934220-105934242 CCTTAGTTCAGCTAAAGGTGGGG - Intergenic
912111592 1:106349085-106349107 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
915656388 1:157364546-157364568 CATTAGTTCAGCTAAAAATGGGG + Intergenic
915656717 1:157366807-157366829 CCTTAGTTCAGCTAAAAACAAGG + Intergenic
915824351 1:159058733-159058755 CCTTATTTCAGCTAAAGACAGGG + Intergenic
915939273 1:160108479-160108501 CCTTAGATCAATTAAAAACATGG + Intergenic
916066278 1:161138428-161138450 CCTTAATTCAACTAAAAACTTGG + Intergenic
916324351 1:163540449-163540471 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
916732181 1:167576048-167576070 CCTTAGTTCAGCTAAAATCCAGG - Intergenic
917076720 1:171213852-171213874 CCATAGTTCAACTAAAGTCGGGG + Intergenic
917077268 1:171218473-171218495 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
917209430 1:172616471-172616493 CCTTAGTTCAGCTAAAAACAAGG - Intergenic
917210092 1:172622295-172622317 CCTTAGTTCAGCTAAAAATGGGG - Intergenic
917371281 1:174297241-174297263 CTTTAGTTCAGCTAAAGACGGGG + Intronic
918704288 1:187641406-187641428 CCTTAATTCAGCTAAAGACGGGG - Intergenic
919102662 1:193113098-193113120 CCCTAGTTCAGCTAAAGACGGGG + Intergenic
919258510 1:195158053-195158075 TCTTAGTTCAGCTAAAGATGGGG + Intergenic
920762660 1:208800391-208800413 CCTTAGTTCAGCTAAAAGCCGGG - Intergenic
921736577 1:218634639-218634661 CCTTAGCTCAGCTAAAATCTGGG - Intergenic
922002527 1:221494597-221494619 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
922086884 1:222357639-222357661 CCTTAGTTCAGTTAAAAATGGGG - Intergenic
922568288 1:226616317-226616339 CCTTAGTTCAGTTAAAGATGGGG + Intergenic
922865044 1:228852509-228852531 CCTTAGTTCAGCTAAGAGCTGGG - Intergenic
923003822 1:230029226-230029248 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
923779194 1:237007205-237007227 CCTTAGGGAAGCTAAAGAGATGG - Intergenic
923908530 1:238413256-238413278 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
923914388 1:238485833-238485855 CCTTAGTTCAGCTGAAGACGGGG + Intergenic
924939046 1:248798063-248798085 CCTCTGATCTGCTAAAGACATGG - Intergenic
1063030059 10:2225563-2225585 CCTAAGTTCAGTTAAAGACAGGG + Intergenic
1063281387 10:4633103-4633125 TCTTAGTTCAGCTAAAAGCCGGG - Intergenic
1063978357 10:11434710-11434732 TCTCAGTTCAGCTAAAAACCAGG + Intergenic
1064334186 10:14423514-14423536 CCTTAGTTCAGCTAAGAGCTGGG - Intronic
1064949924 10:20836852-20836874 TCTTGGTTCAGCTAAAGACAGGG - Intronic
1064960107 10:20954496-20954518 CCTTAGTTCAGCTAAAGATGGGG + Intronic
1065643811 10:27814047-27814069 TCTTGGTTCGACTAAAGACAGGG + Intronic
1065650402 10:27882838-27882860 TCTTAGGTCAAGTAAAGACAAGG - Intronic
1066783707 10:38979501-38979523 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1066979141 10:42395799-42395821 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
1067180082 10:43978858-43978880 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1068438305 10:57019048-57019070 CTTTAGTTCAGCTAAACATGGGG + Intergenic
1068760857 10:60707807-60707829 CCTTAGTTCAGCTAAAGACAAGG + Intronic
1069197437 10:65570693-65570715 CCTTAGTTCAGCTAAAGACTGGG - Intergenic
1071012183 10:80952418-80952440 CCTTAGTTCAGCGAAAGACGGGG + Intergenic
1071044859 10:81361379-81361401 CCTTAGTTCAGCTAAACACGGGG - Intergenic
1071050684 10:81444660-81444682 CCTTAGTTCAGCCAAAATCCAGG - Intergenic
1071555757 10:86600140-86600162 CCTTAGTTCAGGTAAAGACAGGG - Intergenic
1071907346 10:90188438-90188460 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1072015087 10:91338553-91338575 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1072287949 10:93934580-93934602 CCTTAGTTCAGCTAAAAGCCAGG - Intronic
1073574228 10:104608404-104608426 CCTTAGTTCAGCTAAAAATAGGG - Intergenic
1073574775 10:104613150-104613172 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1073886309 10:108043935-108043957 TCTTAGTTCAGCTAAAGATGGGG + Intergenic
1074665168 10:115714229-115714251 CCTTAGTTCAGCTAAAAATGGGG + Intronic
1076812303 10:132893624-132893646 GCTCAGTTCAGCTAAAGACGGGG - Intronic
1078535788 11:12172585-12172607 CCTCAGTTCAGGTAAAAGCAGGG + Intronic
1079324833 11:19482760-19482782 CCTTAGTACTGTTTAAGACATGG + Intronic
1079884089 11:25964269-25964291 CTTTAGTTCAGCTAAAGATGGGG - Intergenic
1081190615 11:40099781-40099803 CCTTAGTTCATCTAAAGATGGGG - Intergenic
1081779500 11:45700149-45700171 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1082633328 11:55566494-55566516 CCTTAGTTCAGCTAAAAACGGGG + Intergenic
1082655930 11:55857119-55857141 CCTTAGTTCAGCTAAGAGCTGGG - Intergenic
1082659820 11:55895817-55895839 CCTTAGTTCAGCTAAGAACTGGG - Intergenic
1082735524 11:56851346-56851368 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1082747692 11:56984350-56984372 CCTTAGTTCAGTTAAAGATGGGG + Intergenic
1082938077 11:58675065-58675087 CCTTAGTTCGGCTAAAAGCCAGG - Intronic
1084879793 11:72162859-72162881 CCTCAGTTCAGCCAAAGACAGGG + Intergenic
1086133631 11:83425078-83425100 CCTTAGTTCAGCTAAAAATGGGG + Intergenic
1086295974 11:85368975-85368997 CCTTCGTTTAGCTAAAGATGGGG - Intronic
1086296544 11:85373805-85373827 CCTTAGTTCAGCTAAAGACGTGG - Intronic
1086974529 11:93116941-93116963 CCTTAGTTCAGCTAAAGGTGAGG - Intergenic
1087127249 11:94640253-94640275 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1087485829 11:98758837-98758859 CCTTATTTCAGCTAAAGATAGGG - Intergenic
1087486715 11:98765581-98765603 CCTTAGGTCAGCTAAAGACAGGG - Intergenic
1087716783 11:101617678-101617700 CCTTAGTTCAGCTGAAGACAGGG + Intronic
1088010509 11:104995237-104995259 CCTTAGTTCAGCTAAAGATGGGG - Intronic
1090196676 11:124822386-124822408 CCTTAGTTCAGGTAAAAACGGGG - Intergenic
1091518597 12:1212554-1212576 TCTTAGTTCAGCTAAAGACGGGG + Intronic
1091670540 12:2449171-2449193 CCTTAAGTCAGCTGAAGACAGGG + Intronic
1092585510 12:9897450-9897472 CCTTAGTTCAGCTGAAATCCAGG + Intergenic
1093122730 12:15292167-15292189 CTTTAATACAGCTAAGGACATGG - Intronic
1093146682 12:15575097-15575119 CCTTAGTTCAGCTAAAGATGAGG + Intronic
1093922038 12:24869516-24869538 CCTTAGTTTAGCTAAAGATGGGG - Intronic
1093983145 12:25497464-25497486 CCTTAGTTTAGCTAAAGACGGGG - Intronic
1094390069 12:29939665-29939687 CCTTAGTTCAGCTAAATATGGGG + Intergenic
1094443668 12:30506799-30506821 CTTCAGTTCAGCTAAAAACCAGG - Intergenic
1094497334 12:30996516-30996538 ACCTAGATCAGCTAAGGACAGGG - Exonic
1095157792 12:38879410-38879432 CCTTAGTTTGGCTAAAGACAGGG - Intronic
1095813117 12:46392592-46392614 CCTTAGTTCAGCTGAAGATGGGG + Intergenic
1097499649 12:60387303-60387325 CCTCTGTTCAGCTAAAGACGAGG + Intergenic
1097812272 12:64032046-64032068 CCTTAGTTCAACTAAAGACAGGG + Intronic
1098435929 12:70468257-70468279 CCTTATTTCAGCTAAAGATGGGG - Intergenic
1098436909 12:70477173-70477195 CCTTAGTTTAGCTAAGGATGGGG - Intergenic
1098805399 12:75015851-75015873 CCTTAGTTTAGCTAAAGACAGGG + Intergenic
1098805963 12:75020359-75020381 CCTTAGTTTAGCTAAAGACAGGG + Intergenic
1099009217 12:77271973-77271995 CCTTAGTTCAGCTAAAGACGAGG + Intergenic
1099188120 12:79537985-79538007 CCAAAGTTCAGCGAAAGAGAGGG - Intergenic
1099308778 12:80991990-80992012 CCTTAGTAAAACTAAAGACCTGG + Intronic
1099534494 12:83827705-83827727 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1099812204 12:87597327-87597349 GCTTAGTTCAGCTAAAAATGGGG - Intergenic
1100233515 12:92634169-92634191 CCTTAGTTCAGCTAAAATCCGGG + Intergenic
1100271590 12:93030154-93030176 CCTTAGTTCAGCTAAGAGCCGGG - Intergenic
1101606435 12:106250139-106250161 CCCTACTTCAGCTAAATACCAGG + Intronic
1102254542 12:111407874-111407896 CCTTCGTTCAGCTGAAGGCGTGG + Intronic
1104262178 12:127194360-127194382 CCTTAGCTGAGCTGGAGACAGGG - Intergenic
1104466571 12:128995274-128995296 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
1106070312 13:26405053-26405075 CCTTACTTCAGCAAAGGAGAAGG + Exonic
1106617187 13:31340506-31340528 CCTTAGTTTAGATAAAGACAGGG - Intergenic
1107104007 13:36624182-36624204 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1107255959 13:38427199-38427221 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1107852881 13:44588536-44588558 TCTTAGTTCAGCTAAAAGCCAGG - Intergenic
1107911383 13:45108695-45108717 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1108000307 13:45900179-45900201 CCTTAGTCCAGCTAAAAACAGGG + Intergenic
1108037918 13:46311529-46311551 CCTTAGTTCAGCTAAAGACGAGG + Intergenic
1108122579 13:47205664-47205686 CCTTAGTTCCTCTAAGGACTTGG + Intergenic
1108584512 13:51858630-51858652 CCTTAGCTCAGCTAAAAACCGGG + Intergenic
1108711600 13:53038309-53038331 CCATAGGTCAGCTAAAGACAGGG + Intronic
1109012536 13:56970132-56970154 CCTCAGTTCAGCTAAAGATGGGG - Intergenic
1109389230 13:61671206-61671228 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1109526809 13:63586475-63586497 CCTTAGTTCAGCTAAAAACGGGG + Intergenic
1109561145 13:64052286-64052308 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
1109744931 13:66612919-66612941 CCTTAGTTCAACTAAAGATGGGG - Intronic
1109745532 13:66618234-66618256 CCTTACTTCAGCTAAAGATGAGG - Intronic
1109865881 13:68261702-68261724 CCTTAGTCCAGCTAAAGACGGGG - Intergenic
1109924044 13:69110317-69110339 CCTTAGTTCAGCTAAAATACAGG - Intergenic
1110256618 13:73440449-73440471 CCTTAGTTCAGTCAAGGACAGGG - Intergenic
1110413337 13:75226574-75226596 CCTTGGTTCAGCTAAAGACGGGG - Intergenic
1110990468 13:82037834-82037856 CCTTAGTTCAGCTAAAGACAAGG + Intergenic
1111079271 13:83280303-83280325 CCTTAGTTCAGCTAAAATCCAGG - Intergenic
1111132562 13:83996345-83996367 CCTTAGTTCAGATAAAGATGGGG - Intergenic
1111562269 13:89966902-89966924 CCTTATGTCAGCTAAAGATGGGG - Intergenic
1111727495 13:92030964-92030986 TCTTAGCTCAGCTAAAAACAGGG - Intronic
1111776448 13:92669547-92669569 CCTTTGTTCATCTAGAAACATGG + Intronic
1112015380 13:95327115-95327137 CCTTAGTTCATCTAAAAACGGGG - Intergenic
1112065007 13:95783755-95783777 CCTTAGTTCAGCTAAAGACAGGG + Intronic
1112192483 13:97191483-97191505 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1112549858 13:100409336-100409358 CCTTAGTTCGGCTAAAGATGAGG + Intronic
1112605749 13:100904236-100904258 CCTTAGTTCAGCTAAAACTCAGG + Intergenic
1113217816 13:108063069-108063091 CCCTAGTTCAGCTAAAAACAAGG + Intergenic
1114440924 14:22747135-22747157 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1115549890 14:34495556-34495578 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1116102835 14:40464320-40464342 CCTTAGTTCAGCTAAAATCCGGG - Intergenic
1116389837 14:44379285-44379307 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1116390441 14:44384524-44384546 CCTTAGTTGAGTTAAAGACGGGG + Intergenic
1116679576 14:47948950-47948972 CCTTAGTTCAGCTGAAAATCAGG + Intergenic
1116762680 14:49033600-49033622 CCTTAGTTCAGCTAAAGATGTGG - Intergenic
1117057391 14:51926855-51926877 CCTTAGTTCAGCTAAAAACGGGG - Intronic
1117285017 14:54278510-54278532 CCTTAGTTCAGCTGAAGATAGGG - Intergenic
1118952502 14:70447134-70447156 CCTTAGTTCAGCTAAAATCCAGG + Intergenic
1120153540 14:81064973-81064995 CCTTAGTTCAGCTAAAAGCCAGG + Intronic
1120320605 14:82956050-82956072 CCATAGTTCAGCTAAAGATGGGG + Intergenic
1120477032 14:85001717-85001739 CCTTAGTTTAGCTAGAGACGGGG + Intergenic
1120571970 14:86129819-86129841 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1120952715 14:90057206-90057228 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1121486247 14:94317645-94317667 ACTTAGTCCAGCTAAACACGGGG - Intronic
1121850761 14:97219385-97219407 ACTGAATTCAGCTAAACACACGG - Intergenic
1126145788 15:45471641-45471663 CCCTAGTTAAGCTACAGGCAGGG - Intergenic
1126570600 15:50146648-50146670 CCTTAGTTCAGCTAAAGACAGGG + Intronic
1127348293 15:58124276-58124298 CCTTAGCTCAGCTAAAAACGGGG + Intronic
1128534713 15:68481752-68481774 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1133052837 16:3127578-3127600 CCTTAGCTCAGTTCAAGTCATGG - Intergenic
1135077052 16:19402806-19402828 CTTTAGTTCAGCTAAAGATGGGG + Intergenic
1135077600 16:19407548-19407570 CCTTAGTTCAGCTAAAGATAGGG + Intergenic
1135788178 16:25368968-25368990 CCTTAGTTCAGCTAAAATCTGGG - Intergenic
1137330748 16:47492876-47492898 CCTTAGTTCACCTAAAAATGGGG + Intronic
1137815923 16:51397445-51397467 CCTTAGTTTAGCTAAAAATGGGG + Intergenic
1137980867 16:53068447-53068469 CAGTACTTCAGCTAAACACAGGG + Intronic
1138174552 16:54884722-54884744 CCTTAGTTCAGCTAAAAACGGGG - Intergenic
1138864055 16:60795046-60795068 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
1138975448 16:62201894-62201916 CTTTAGTTCAGCTAAAGACAGGG + Intergenic
1139029288 16:62859941-62859963 CCTTAGTTCAGCCAAAAACGGGG + Intergenic
1143120451 17:4603294-4603316 GTTTAGTTCAGAGAAAGACATGG + Intronic
1143735395 17:8908832-8908854 CCTGAGTTCAGCTACAGACATGG - Intronic
1144228557 17:13175662-13175684 CCTTAGGTCAGCTAAAATCTGGG - Intergenic
1145789023 17:27613309-27613331 CCTTAGCTCAGCTAAAATCCAGG + Intronic
1146486835 17:33249771-33249793 CCTTAGTTCCACCAAAGGCAGGG + Intronic
1147299412 17:39512727-39512749 CCTGAGTTCAGCCAAACAGATGG - Intronic
1147855059 17:43473383-43473405 CATGAGTTTAGCTAAAGACCAGG - Intergenic
1149034730 17:52120927-52120949 CCTTAGTTCAGCTAAAATCCAGG - Intronic
1149094456 17:52824482-52824504 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1149094932 17:52828598-52828620 CTGTAGTTCAGCTAAAGACGAGG + Intergenic
1149107612 17:52988198-52988220 CCTCAGTTCAGCTAAAAGCTGGG - Intergenic
1149891768 17:60395866-60395888 CCTTAGGTAAGCTAGAGAGAGGG + Intronic
1150595772 17:66603063-66603085 CTTTAGTTCAGCTAAAAGCCGGG - Intronic
1152534618 17:80943327-80943349 TTTTAATTCAGCTAAAAACAGGG + Intronic
1152902279 17:82949623-82949645 TCTTAGTTCAGCTGAAGAATGGG - Intronic
1153134608 18:1900649-1900671 CTTTAAATCAGCTAATGACATGG - Intergenic
1155593416 18:27454252-27454274 CCTTACTTCAGCTAAAGACGGGG + Intergenic
1155606865 18:27616127-27616149 CCTTAGTTCAGCTAAAAACGGGG - Intergenic
1155784414 18:29879558-29879580 CCTTACTTCAGCTAAAGATGTGG + Intergenic
1155784956 18:29884316-29884338 CCCTAGTTCAGCTGAAGATGGGG + Intergenic
1155797608 18:30059761-30059783 CTTTAGTTCAGCTAAAAGCTGGG + Intergenic
1156047286 18:32890713-32890735 CTTTAGTTCAGATAAACATAGGG - Intergenic
1156971504 18:43162726-43162748 CCTTAGTTCAGCTAACGACTGGG - Intergenic
1157163712 18:45338509-45338531 CATTGGTTCAGCTAAAGAGGTGG - Intronic
1157821617 18:50775606-50775628 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1158641541 18:59207898-59207920 CCTTAGCTCAGCTAAAGTCAGGG - Intergenic
1159134870 18:64326154-64326176 CCTTAGCTCAGCTAAAGACGGGG + Intergenic
1159655098 18:71023816-71023838 CCTTAGTTTAGCGAAAGATGGGG + Intergenic
1159783961 18:72692518-72692540 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1159784632 18:72698095-72698117 CCTTAGTTCAGCTACAGACGGGG - Intergenic
1160169060 18:76537915-76537937 CATTAGTCCTTCTAAAGACAGGG + Intergenic
1160325594 18:77944656-77944678 TCTTAGTTCAGGTAACGACGAGG - Intergenic
1161163715 19:2774239-2774261 GCTCAGTTCAGCTGGAGACAGGG - Intronic
1164611309 19:29634235-29634257 CCTATGTTCACCCAAAGACATGG + Intergenic
1167393277 19:49210891-49210913 CCTGACTTCAGCTGAAGGCAGGG + Intronic
925160673 2:1681400-1681422 CCCTAGTTCAGCGAAAGATGGGG - Intronic
925538479 2:4941163-4941185 TCTTAGTTCATCTAAAGACGGGG + Intergenic
926239184 2:11071663-11071685 CCTCAGTTCAACTAAAAACCAGG - Intergenic
926344425 2:11932268-11932290 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
926838900 2:17056625-17056647 CCTTAGTGCAGCTAAAAACGGGG - Intergenic
927045338 2:19272522-19272544 CCTTACTTCAGCTAAAGATGGGG - Intergenic
928182920 2:29082433-29082455 CCTTAGTTCAGTTAAAGACGGGG + Intergenic
928833406 2:35516758-35516780 CCTTAGTTCAACTAAAATCTGGG + Intergenic
928959164 2:36905859-36905881 TCTTAGTCTAGTTAAAGACAGGG - Intronic
929115738 2:38442398-38442420 CCTTAGTTCAGCTAAGAGCTGGG - Intergenic
930545422 2:52761557-52761579 TCTTAGTTCAGCTAAAGACAGGG + Intergenic
930630721 2:53752266-53752288 CCTTAGTTCAGCTAAAATCCGGG + Intronic
930980913 2:57524635-57524657 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
931938702 2:67228452-67228474 CCTTAGTTCAGCTGAAGATGGGG + Intergenic
932831918 2:74998529-74998551 CCTTAGTTCAGCTAAAATCCGGG + Intergenic
933131413 2:78677739-78677761 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
933495056 2:83040348-83040370 CCTTAGTTCAGCTGAAAGCTGGG + Intergenic
935338110 2:102035408-102035430 CCTTAGTTCAGCTAACAGCCAGG - Intergenic
935597285 2:104889192-104889214 CCTTAGTTCAGCTAAGAGCCGGG + Intergenic
935724491 2:106011161-106011183 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
936156887 2:110052871-110052893 CCTTAGTTCAGCTAAGAGCCAGG + Intergenic
936187807 2:110318573-110318595 CCTTAGTTCAGCTAAGAGCCAGG - Intergenic
936461632 2:112718568-112718590 CCTAAGTTCAGCTATAGGAAAGG + Intergenic
936487136 2:112935604-112935626 CCTTACTTCAGCAAAGGAGAAGG + Intergenic
936578646 2:113676297-113676319 CCTTAGTTCAGCTAAGAGCTGGG - Intergenic
936639623 2:114297639-114297661 CCTTAATTCAGCTAAAAACAGGG + Intergenic
936840217 2:116758949-116758971 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
937153088 2:119699407-119699429 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
937602374 2:123754377-123754399 CCTTAGTTCAGCTAAAGGCAGGG + Intergenic
937648994 2:124298964-124298986 CCTTAGTTTAGCTAAACATGGGG + Intronic
937720343 2:125088119-125088141 CCTTAGTCCAGTTAAAAACCTGG + Intergenic
937727518 2:125185676-125185698 CCTCAGTTCAGCTAAATACGGGG + Intergenic
937727812 2:125187739-125187761 CCTTAGTTCATCTGAAGACTGGG + Intergenic
938994391 2:136661862-136661884 CTTTGGTTCAGCTAATGAGATGG + Intergenic
939390003 2:141556034-141556056 CATTAGTTTAGATAAATACATGG - Intronic
939847600 2:147267635-147267657 CCTGAGGACAGCTAGAGACAAGG - Intergenic
940189956 2:151030606-151030628 CCTTAGTTCGGCTAAAGATGGGG + Intronic
940319793 2:152364904-152364926 CCTTAGTTAAGCTGAAGATTCGG + Intronic
940391126 2:153133568-153133590 CCTCAGTTCAGCTAAAAACCGGG - Intergenic
940612817 2:156011619-156011641 CCTTAGTTCACCTAAAAATGCGG - Intergenic
942084273 2:172428989-172429011 CCTTAGTTCAACTCAAGGCCTGG - Intronic
942109254 2:172663870-172663892 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
943214441 2:185012803-185012825 CCTTAGTTCAGCTGAAGATGGGG - Intergenic
943253861 2:185567887-185567909 CCTTAGTTCAGCTAAAACCCAGG + Intergenic
943258511 2:185628866-185628888 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
943258727 2:185630511-185630533 TCTTAGTTCAGCTAAAGATGGGG + Intergenic
943420171 2:187659476-187659498 CCTTAGTTCAGCTAAAAACAGGG - Intergenic
943834233 2:192499135-192499157 CCTTATTTCAGCTAAAGACGTGG - Intergenic
943883760 2:193183889-193183911 CCATAGTACAGTGAAAGACACGG - Intergenic
943905855 2:193501028-193501050 CCTTAGTTTAGCTAAAGATGGGG + Intergenic
944087727 2:195869017-195869039 CCTTAGTTCAGCTAAAGGTGGGG + Intronic
944964430 2:204914321-204914343 CTTTAGTTCAGCTAAAAACGGGG - Intronic
945217281 2:207447084-207447106 CCTTGGTTCAGCTAAAAGCTGGG - Intergenic
945561595 2:211347168-211347190 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
945631927 2:212288711-212288733 CTTTAGTTGAGCTAAAAACGGGG - Intronic
946111400 2:217421040-217421062 CCAGAGTTCAGCTAAAGTCCTGG - Intronic
946439781 2:219685474-219685496 CCTTAGTTCAGCTAAAAACGGGG - Intergenic
946885413 2:224217593-224217615 CCTTAGTTCAGCTAAATACAGGG - Intergenic
947103003 2:226641325-226641347 CCAGAGATCAGCAAAAGACAAGG + Intergenic
947136224 2:226979247-226979269 CCTCAGTTCAGCTAAAAACTAGG + Intronic
947227813 2:227857200-227857222 CCTTAATTCAGCTGAAGATGGGG + Intergenic
947274529 2:228375130-228375152 CCTTAGTTCAGCTACTTACCTGG + Intergenic
948732122 2:239972371-239972393 CCTTAGTGCATCTAGAGAGAGGG - Intronic
1169699648 20:8432084-8432106 CCTTAGTTCAGCTGAAGACAGGG + Intronic
1169780696 20:9306899-9306921 CCTTAGTTCAGCTAAAAACAGGG + Intronic
1169967761 20:11236560-11236582 CCTTAGTTCAGCTAAAGACAAGG + Intergenic
1170220609 20:13937603-13937625 CCTTAGTTCAGCTAAAACCCAGG - Intronic
1170222382 20:13953816-13953838 CCTTAGTTCAGCTAAAAACAGGG - Intronic
1170276380 20:14595189-14595211 CCTTAGTTCAGCTAAAAGCCCGG + Intronic
1170335719 20:15268008-15268030 CCTCAGTTCAGCTAAAAACTGGG - Intronic
1170780501 20:19421604-19421626 CCTTAGTTCAGCTAAAGATGTGG + Intronic
1170877871 20:20267647-20267669 CCGTAGTTCAGCTAAAGATGGGG + Intronic
1170946968 20:20900238-20900260 CCTTAGTTCAGCTAAAATCCTGG + Intergenic
1171358229 20:24567071-24567093 CCTTAGTTCAGCTAAAGACAGGG + Intronic
1172112644 20:32556373-32556395 CCTGAAGTCAGCAAAAGACAAGG + Intronic
1174452729 20:50629748-50629770 CCATTGTTCAGATGAAGACAAGG + Intronic
1176886473 21:14261581-14261603 CCTTAGTTCAGCTAAAAATTGGG - Intergenic
1176972303 21:15280916-15280938 CCTTAGTTCAGCTAAAAGCTGGG + Intergenic
1177192398 21:17866560-17866582 CCTTAGTTCAGCTAAAGAGGGGG + Intergenic
1177305256 21:19306837-19306859 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1177455329 21:21330853-21330875 ACTTAGTTCACTTGAAGACATGG - Intronic
1177543177 21:22521407-22521429 CCTTAGTTCATCCAAAAACAGGG - Intergenic
1177567344 21:22842848-22842870 CCTTAGTTAAGCTAAAATCCAGG + Intergenic
1177759561 21:25388274-25388296 CCTTAGTTCACCTAAAAGCCAGG + Intergenic
1178044333 21:28676838-28676860 CCTTAGTTCCACTAAAGATGTGG - Intergenic
1178620089 21:34166683-34166705 CTTTAGTTCAGCTAAAGGTGGGG + Intergenic
1179140513 21:38721033-38721055 CCTTAGTTCAGCTAAAACCAGGG + Intergenic
1179956223 21:44740662-44740684 CCTTAGCTCAGCTAAAACCTGGG - Intergenic
1181151859 22:20889893-20889915 CATCAGTCCAGCAAAAGACAGGG - Exonic
1181453951 22:23044501-23044523 TCTTAGTTCAGCTAAAGATGGGG + Intergenic
1183759102 22:39799413-39799435 CCTTAGTTCAGCTAAAATCCAGG + Intronic
1184043696 22:41958943-41958965 CCTCATTTCAGGAAAAGACAGGG - Intergenic
1185225574 22:49649971-49649993 CCTTTATTCAGCTAAAAGCACGG + Intronic
949307432 3:2658383-2658405 CCTTAGCTCAGCTAATGATGGGG - Intronic
949363004 3:3251842-3251864 CCATAGTTCAGCTAAAAGCCAGG + Intergenic
949571631 3:5299575-5299597 CCTTAGTTCAGCTAAAAGTCGGG + Intergenic
949805359 3:7949564-7949586 CCTTAGTTCGGCTAGAGATGAGG - Intergenic
949811897 3:8015476-8015498 CCTTAGTTCAGCTAAAAATGGGG + Intergenic
949812513 3:8021004-8021026 CCTTAGTTCAGCTAAAAACAGGG + Intergenic
951193756 3:19802099-19802121 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
951303531 3:21028368-21028390 CCTTAGTTCAGCTAAAACCCAGG + Intergenic
951346127 3:21548208-21548230 CCCTAGTTCAGTTAAAGACTGGG - Intronic
951829843 3:26914445-26914467 GCTTAGTTGAGCTAGAGACAGGG + Intergenic
952193477 3:31047712-31047734 CCTTAGCTCAGATAAAGATAGGG - Intergenic
952636988 3:35544871-35544893 CCTCAGTTCAGCTAAAAACTGGG + Intergenic
953441091 3:42918213-42918235 CCTTAGTTCAGCTAAAATCTGGG + Intronic
953648092 3:44773795-44773817 CCTTAGCTCAGCTAAAATCCAGG + Intronic
954598273 3:51846031-51846053 CCTTAGTTCAGCTAAAAATGGGG + Intergenic
955333082 3:58063465-58063487 CGTCAGCTGAGCTAAAGACAGGG + Intronic
955612796 3:60775585-60775607 CCATAGTTCAGTTAAAGACAGGG - Intronic
955613435 3:60781040-60781062 CCTTAGTTCAGCTAAAGAGAGGG - Intronic
956247724 3:67203016-67203038 CTTTAGTGCAGCTAAAGATGGGG - Intergenic
956282618 3:67573870-67573892 CCTTAGTTCAGCTAAAGATGGGG - Intronic
957028250 3:75209476-75209498 CCTTAGTTCAGCTAAAATCCAGG - Intergenic
957288413 3:78246607-78246629 CATTAATTCAGCTAAAGATGGGG - Intergenic
957549874 3:81690017-81690039 CCTTAGTTCAGCTAAATACAGGG - Intronic
957574680 3:81991636-81991658 CCTTAGGTCAGCTAAAGACAGGG - Intergenic
957952742 3:87146093-87146115 CCTTAATTCAGCTAAAGGTGGGG - Intergenic
957986829 3:87582575-87582597 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
957990226 3:87617614-87617636 TCTTAGTTCAGCTGAAGATGGGG + Intergenic
957991896 3:87636611-87636633 TCTTAGTTCAGCTAAAATCCAGG - Intergenic
958744430 3:98114874-98114896 CCTTAGTTCAGCTAAGAGCCAGG - Intergenic
958974646 3:100653890-100653912 CCTTTGTTCAGCTAAAAGCTGGG + Intronic
959401989 3:105913967-105913989 TCTTAGTTCAGCTAAAAATGGGG - Intergenic
959429663 3:106236876-106236898 CCTTAGTACAGCTAAAGTCCAGG - Intergenic
959431101 3:106256293-106256315 CCTTAGTTCAGGTAAAAATGTGG - Intergenic
959623383 3:108422970-108422992 CCTTAGTTCAGCTAAAGATGGGG + Intronic
959632612 3:108525104-108525126 CCTAATTTCAGCTAAAGATTGGG + Intronic
959820578 3:110730307-110730329 ATTTAGTTCAGCTGAAGACGGGG - Intergenic
960078890 3:113519413-113519435 CCTTAGATCAGAAAAAGACAAGG + Intergenic
960504699 3:118478703-118478725 CCTTAGTTCGGCTAAAAGCCAGG - Intergenic
962065145 3:131971799-131971821 CCTTAGCTCAGCTACAGGAATGG - Intronic
962126748 3:132627367-132627389 CCTTAGTTCAGCTAAAATCCAGG - Intronic
964073069 3:152658943-152658965 CCCTAGTTCAGCTAAAGATGGGG + Intergenic
964304481 3:155325853-155325875 TCTTAGCTCAGCTGAAAACAGGG - Intergenic
964368096 3:155970801-155970823 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
964446265 3:156762286-156762308 TCTTTCTTCTGCTAAAGACAGGG - Intergenic
964980423 3:162670610-162670632 CCTTAGTTTAGCTAAAGACAGGG - Intergenic
965027667 3:163324252-163324274 CCTTAGTTCAGCTAAAGTTGGGG - Intergenic
965028225 3:163329281-163329303 CCTTAGTTCAGCTAAAGAAAGGG - Intergenic
965224858 3:165975164-165975186 CCTTAGTTCAGCTAAAAGCTGGG + Intergenic
965240072 3:166185706-166185728 AGTCATTTCAGCTAAAGACATGG + Intergenic
965786193 3:172337947-172337969 CCCTAGTTCATAAAAAGACATGG - Intronic
966298840 3:178455934-178455956 CCTTAATTCAGTTAAAGATGGGG + Intronic
966523148 3:180894763-180894785 CCTTCATTCAGCTAAAGATGGGG - Intronic
966523885 3:180900449-180900471 CCTTAGTTCAGCTAAAGATGGGG - Intronic
967212798 3:187183662-187183684 GCTTAGTTCAGCTAAAACCTGGG - Intergenic
967256057 3:187593264-187593286 CCTTAGTTTAGCTAAAAATTGGG + Intergenic
967509638 3:190294265-190294287 ACTTAGTTCAACTAAAAAAATGG + Intergenic
967537254 3:190620752-190620774 CCAGAGTACAGATAAAGACAGGG - Intronic
967630278 3:191737404-191737426 CCTTAGTTCAGGTAAAGACGAGG + Intergenic
967657159 3:192064002-192064024 CCTTAGTTCAGCTAAGAGCCAGG - Intergenic
969190719 4:5516501-5516523 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
970260364 4:14217841-14217863 CCTTAGTTTAGCTAAAGATAGGG - Intergenic
970721345 4:18992821-18992843 CCTTAGTTCAGCTAAAATCTGGG - Intergenic
971364409 4:25966087-25966109 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
971616435 4:28795685-28795707 CCTTATTTCAGCTAAAAATGAGG - Intergenic
971711451 4:30118600-30118622 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
971811439 4:31432932-31432954 CCTTAGCTCAGCTAAAATCTGGG - Intergenic
972163554 4:36254869-36254891 CCATATTTCAGCTAAACACATGG + Intergenic
972472556 4:39421134-39421156 CCATAGATCATCTAAAGGCAGGG + Intronic
973226490 4:47790548-47790570 CCTTAGTTCACCTAAAAGCTGGG - Intronic
974159000 4:58112906-58112928 CCTTAGTTCAACTAAAGATGGGG + Intergenic
974165465 4:58195777-58195799 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
974665294 4:64953659-64953681 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
974674804 4:65076255-65076277 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
974675316 4:65080326-65080348 CCTTAGTTCAGCTAAAGTCGTGG - Intergenic
974960772 4:68697337-68697359 TCTTAGTTCAACTAAAAGCAAGG - Intergenic
975182287 4:71360830-71360852 CCTTAGTTCAGTTAAAGACGGGG + Intronic
975222757 4:71832426-71832448 CCTTAGTTCAGCTAAAAACAGGG - Intergenic
975223148 4:71837868-71837890 CATTAGCTCTTCTAAAGACAGGG + Intergenic
975228232 4:71899591-71899613 TCTTAGTTCAGCTAAAACCCAGG - Intergenic
976344931 4:83989727-83989749 CCTTAGTTCAGCTAAAAATGGGG - Intergenic
976345456 4:83994359-83994381 CCTTAGTTCAGCTAAAAACAGGG - Intergenic
976690713 4:87864331-87864353 CCTTAATTCAGCTAAAGGCAGGG + Intergenic
976751536 4:88455244-88455266 CCTTAGCTCAGCTAAAATCCAGG + Intergenic
976826257 4:89263648-89263670 CCTTAGTTCAGCTAAAGATGGGG - Intronic
977685614 4:99844066-99844088 CCTTAGTTCAGCTAAAGATCGGG + Intronic
978918098 4:114149310-114149332 CCTTAGTTCAGCTAAATATGGGG + Intergenic
979105821 4:116685963-116685985 CTTTAGTTCAGCTAAAGATGGGG + Intergenic
979507525 4:121514934-121514956 CCTTAGTTCAGCTAAAAGCCAGG - Intergenic
980237213 4:130124021-130124043 GGTTAGTTCAGCTGAACACAGGG - Intergenic
980387846 4:132110414-132110436 CCTTAGTTGAGCTAAAGACGGGG + Intergenic
980571689 4:134627806-134627828 CCTTAGTTGAGCTAAAGACAGGG - Intergenic
980722487 4:136716673-136716695 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
980723049 4:136721516-136721538 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
980726647 4:136770109-136770131 CCTTAGTTCAGCTAAATAGAGGG - Intergenic
980823397 4:138044937-138044959 CCTTAGTTCAGCTAAAATCCAGG + Intergenic
981256072 4:142661238-142661260 TCTTAGTTCAGCTAAAGACTGGG - Intronic
981764213 4:148229428-148229450 GCTTAGTTCAGCTAAAATCCAGG - Intronic
981770081 4:148299194-148299216 CCTTAGTTCAGCTAAAATCTAGG - Intronic
981770785 4:148304996-148305018 CGTTAGTTCAGCTAAAACCTGGG - Intronic
982890094 4:160836197-160836219 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
983321156 4:166198441-166198463 CCTTAGTTCAGTTAAAGACGGGG - Intergenic
983321750 4:166203414-166203436 CCTTAGTTCAGCTAAAGGTGGGG - Intergenic
983552706 4:169033633-169033655 CCTTAGTTCAGCTAAATCTCAGG + Intergenic
983862098 4:172720184-172720206 CCTTAGTTCAGCTAATGACGGGG + Intronic
983901553 4:173141112-173141134 CCTTGCTTCAACTTAAGACAGGG + Intergenic
984055936 4:174929390-174929412 CATTAGTTCAGCTCAAGATGAGG + Intronic
984244997 4:177264214-177264236 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
984327359 4:178271214-178271236 CCTTAGTTCAGCTAAACTCCAGG - Intergenic
984432538 4:179666610-179666632 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
984896892 4:184549010-184549032 CCTTAGTTCAGCCAACCACGGGG + Intergenic
985385961 4:189448475-189448497 CCTTAGTTCAGGTAAAGACAGGG - Intergenic
985919924 5:2962453-2962475 CCTTAGTTCAGCTAAAATCCTGG + Intergenic
986177807 5:5366705-5366727 CCTTAGTTCAGCTGAAAACGGGG + Intergenic
987082096 5:14435105-14435127 CCTTAGTTCAGCTAAAGACAGGG + Intronic
987322049 5:16779075-16779097 CCTTTGTTCAGCTAAAACCTGGG - Intronic
987889966 5:23864219-23864241 CCTTAGTTCTGCTAAAGATGGGG - Intergenic
987994830 5:25263446-25263468 CCTTAGTTCAGCTAAAAGTGGGG + Intergenic
988157340 5:27472448-27472470 CCTTAGTTCAGCTAATACCTGGG - Intergenic
988157902 5:27477934-27477956 CCTTAGTTCAGCTAAAACCTAGG - Intergenic
988659272 5:33246833-33246855 CCTTAGTTTAGCTAAAAGCTAGG - Intergenic
988899496 5:35717504-35717526 CCTTAGTTCAGCTAAAGACGGGG + Intronic
989187989 5:38643284-38643306 CCTCAGTTCAGCTAAAAACTGGG + Intergenic
991605662 5:68398022-68398044 AGTTAGTTGAGCTTAAGACAGGG + Intergenic
992662972 5:78979738-78979760 CCTTAGTTCAGCTAACGATGAGG - Intronic
992859225 5:80894461-80894483 CCTTAGTTCAGCTAAAATCCAGG - Intergenic
993086994 5:83375357-83375379 CCTTCCTTCTGCTAAAGACTAGG + Intergenic
993236718 5:85320449-85320471 CCTTGGTTCAGCTAAAATCTCGG + Intergenic
994360832 5:98846482-98846504 CCTTAGTTCAGCTAAAATCTGGG + Intergenic
994505921 5:100642434-100642456 CCTTAGTCCAGCTAAAGACAGGG - Intergenic
994852643 5:105075585-105075607 CCTTAGTTCAGCTAGAAACCGGG + Intergenic
995205777 5:109479320-109479342 TTTTAATTCAGCTAAAGTCATGG + Intergenic
995393361 5:111663055-111663077 CTTTAGTTCAGCTAAAGACAGGG + Intronic
995393848 5:111666805-111666827 CCTTAGTTCAGCTAAAGATGGGG + Intronic
995635516 5:114185669-114185691 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
995829845 5:116343847-116343869 CCTTAGTTCAGCTAAAGACGGGG + Intronic
995830404 5:116348587-116348609 CCTTAGTTCACCTAAAGAGGGGG + Intronic
996278129 5:121693737-121693759 CCTTATTTCAGCTGAAAATAGGG + Intergenic
996553869 5:124757954-124757976 CCTTGGTTCAGCTAACAACAGGG - Intergenic
996661548 5:126009326-126009348 CCTTAGTTCAGCTAAAAACAGGG - Intergenic
996665101 5:126049885-126049907 CCTTAGTTCAGCTAAAGATAGGG - Intergenic
996709062 5:126525985-126526007 CCTTAGTTCAGCTAACAACGGGG - Intergenic
996834063 5:127771768-127771790 CCTTAGTTCAGCTAAAGATAGGG + Intergenic
997082731 5:130759463-130759485 CCTTTGTTCAGCTAAAAGCCGGG - Intergenic
997967326 5:138368787-138368809 CCTTACTTGAGCAAAGGACATGG - Intronic
998189217 5:140008275-140008297 CCTTATTTCAGCCAAACAAAAGG + Intronic
998741307 5:145205167-145205189 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
999008364 5:148006624-148006646 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
999534185 5:152499466-152499488 CCTTAGTTCAGCTAAAGGCTGGG + Intergenic
999897568 5:156051956-156051978 CCTTAGTTCAGCTAAAGACAGGG + Intronic
1000022746 5:157332907-157332929 TCTCAGTTCAGCTAAAGATGGGG + Intronic
1000394494 5:160759526-160759548 CCTGAGTTCAGTAAAACACATGG - Intronic
1000643588 5:163735050-163735072 CCTTAATTCAGCTAAAGATGGGG + Intergenic
1001915207 5:175554790-175554812 CCTTAGTTCAGCTAAAAACGGGG + Intergenic
1001915593 5:175557694-175557716 CCTTAGTTCAGCCAAAAACCAGG + Intergenic
1002525171 5:179811613-179811635 CCTTAGTTCAGCTAAAAGCCAGG - Intronic
1003196500 6:3919764-3919786 TCTTAGTTCAGCTAAAGACAGGG + Intergenic
1005025302 6:21457630-21457652 CCTTAGTTCAGCTAAAGATGCGG + Intergenic
1005042096 6:21609088-21609110 CCTTGGTTCAGCTGAATACAGGG - Intergenic
1005564682 6:27079028-27079050 CCTTAGTTCAGCTAAAAACCGGG - Intergenic
1005577988 6:27208038-27208060 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1005787915 6:29264962-29264984 CCTTAGTTCAGCTAAAAAGGGGG - Intergenic
1008149602 6:47934375-47934397 TCGTAGTTCAGCTAAAGATGGGG - Intronic
1009603820 6:65838964-65838986 CTGTAGTTCAGCTAAAGACAGGG - Intergenic
1009632424 6:66215412-66215434 CCTTAGCTCAGCTAAAATCTGGG - Intergenic
1009840910 6:69073397-69073419 CCTTAGTTCAGCTAAGAGCCGGG + Intronic
1010368079 6:75075979-75076001 CCGTAGCTCAGCTAAAGACAGGG + Intergenic
1010453179 6:76026260-76026282 CCTTAGTTCAGCTAAAGACAAGG - Intronic
1010453763 6:76031121-76031143 CCTTAGTTCAGCTAAAATTGGGG - Intronic
1010669697 6:78673791-78673813 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
1011447822 6:87461757-87461779 CCTGATTTCAGTTAAAGAGATGG - Intronic
1011590486 6:88966108-88966130 CCTTAGTTCAGCTAAGAGCTGGG - Intergenic
1011882415 6:92046001-92046023 CCTTAGTTCAGCTAAAGTCAAGG - Intergenic
1012308456 6:97689446-97689468 CCTTAGTTCAGCTAAAGGCAGGG - Intergenic
1012595490 6:101032985-101033007 CCTTAGTTCTGCTAAAATCCAGG - Intergenic
1012629167 6:101442168-101442190 CCTTAGTTCAGCCAAAAACCAGG + Intronic
1012742764 6:103040904-103040926 CCTTAGTTCAGCTAAAATCTGGG + Intergenic
1012804821 6:103880012-103880034 CCTTAGTTCAGCTAAAACCTAGG - Intergenic
1013410190 6:109876954-109876976 CCTAAGTTCAGCTAAAAACGGGG - Intergenic
1013994448 6:116291974-116291996 CAACAGTTCAGCTACAGACAAGG + Intronic
1014470505 6:121808709-121808731 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
1014956341 6:127621533-127621555 CCTTAGTTCAGCTAAAATCTGGG - Intergenic
1015043011 6:128744418-128744440 CCTTAGTTCAGCTAAAGACAGGG + Intergenic
1015267256 6:131301313-131301335 CCTTAGTTCAACTAAAGATGGGG - Intergenic
1015803128 6:137080732-137080754 CCTTAGCTCAGCTAAAGACAGGG + Intergenic
1015859155 6:137657101-137657123 CCTTAGTTCAGCTAAAGACAGGG - Intergenic
1016187276 6:141212271-141212293 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1016196335 6:141347083-141347105 CCTTATTTCAGCTAGAGGGAAGG - Intergenic
1016686121 6:146884229-146884251 CCTTAGTTCAGCTAAAGACGAGG - Intergenic
1016686267 6:146885818-146885840 CCTTTGTTCAGCTAAAAATGGGG + Intergenic
1017343411 6:153353105-153353127 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1017361660 6:153579611-153579633 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1017377481 6:153787644-153787666 CCTTAGTTCAGCTGAAGACAGGG - Intergenic
1017423213 6:154294787-154294809 CCTTAGTTCAGCTAAAAGCCAGG - Intronic
1018239663 6:161760698-161760720 CCTTAGTTCAGCCATGGACGGGG - Intronic
1018359632 6:163054552-163054574 CCTTAGTTCGGCTGAAGACAGGG + Intronic
1019473616 7:1233685-1233707 CCCGAGTTCAGGTAAAGACCCGG + Exonic
1020676696 7:11192248-11192270 CCTTAGTTCAGCCAAAGTCGGGG - Intergenic
1020677373 7:11197790-11197812 CCTTAGTTCCGCTAAAGACGGGG - Intergenic
1021055045 7:16036492-16036514 CCTTAGTTCAGCTAAAGGCAGGG - Intergenic
1021331001 7:19339466-19339488 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1021456499 7:20835116-20835138 GCTTAGTTCAGCTAAAGACAGGG + Intergenic
1021597948 7:22336865-22336887 CCTTAGCTCAGCTAAAGATGGGG - Intronic
1022262960 7:28724405-28724427 CCTTAGTTCAGCTAGGTAGAGGG + Intronic
1022322055 7:29297023-29297045 TCTTAGTTCAGGTAAAGACAGGG + Intronic
1023022172 7:36020017-36020039 CCTCACTTCAGCTGAAGACACGG - Intergenic
1023359511 7:39400863-39400885 CCTTAGTTCAGCTAAAGATGAGG + Intronic
1023367372 7:39477152-39477174 CTTTACTTCAGCTGAAGACTGGG + Intronic
1023682903 7:42706274-42706296 CCTTAGTTCAGCTAAAGACTGGG + Intergenic
1023718691 7:43071471-43071493 GGTCTGTTCAGCTAAAGACAGGG + Intergenic
1023719427 7:43077735-43077757 TTTTAGTTCAGCTAAAGACAGGG + Intergenic
1023970962 7:44990664-44990686 TCTTAGTTCAGCTAAAATCTGGG + Intergenic
1024035267 7:45502832-45502854 CCTTAGTTCAGCTAAAAGCCAGG + Intergenic
1024112595 7:46162311-46162333 CCTTAGCTCAATTAAAGACAGGG + Intergenic
1024222163 7:47297469-47297491 CCTCAGTCTAGCTAAAGAGAGGG - Intronic
1024491017 7:49986068-49986090 CCTTAGTTCAGCTAAAATCTAGG - Intronic
1024655487 7:51448204-51448226 CCTTAGTTCAGTTAAATATAGGG - Intergenic
1025983844 7:66430196-66430218 CCTTAGTTCAGCTAAGGACGGGG + Intergenic
1027207050 7:76108945-76108967 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1027660371 7:80981373-80981395 CCTTAGTTCAGCTAAAAATGAGG + Intergenic
1027662630 7:81005613-81005635 CCTTTGTTCAGCAAAAGACGGGG - Intergenic
1028235888 7:88361199-88361221 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1028524400 7:91767799-91767821 CCTTAGATCAGCTAAAGACTGGG + Intronic
1028738349 7:94243696-94243718 CCTTAGTTCAGTTAAAGACGGGG - Intergenic
1028756461 7:94440696-94440718 CCTTAGTTTAGCTAATGACAGGG + Intergenic
1028861761 7:95659347-95659369 CCTTAGTTTAGCTAAAGACTGGG - Intergenic
1030245968 7:107384604-107384626 CCTTAGTTCAGCTAACGATGGGG - Intronic
1030589684 7:111465381-111465403 CCCTACTTCAGCCAAAGAAATGG + Intronic
1031021004 7:116627273-116627295 CCTTAGTTGAGCTAAAGATGGGG - Intergenic
1031616483 7:123887902-123887924 CCTTAGTTCAGCTAAAATCCAGG - Intergenic
1031648968 7:124262131-124262153 ACTTAGCTCAGCTAAAGTAAAGG - Intergenic
1031834644 7:126668287-126668309 CCTTAGTTCAGCTAGCGATGGGG - Intronic
1031835225 7:126673300-126673322 CCTTAGTTCAACTAAAGACAGGG - Intronic
1031842293 7:126758729-126758751 ACTTAGCTTAGCTAGAGACAAGG + Intronic
1032754486 7:134875692-134875714 CCTTAGTTCAGCTAAAGACAGGG - Intronic
1032935168 7:136721061-136721083 CCATAATTCAGCTGGAGACAGGG - Intergenic
1033083165 7:138317404-138317426 CCTTAGTTCAGCTAAGAGCCAGG + Intergenic
1033131720 7:138750904-138750926 CCTTCGTACAGATAAAGAAATGG - Intronic
1033464330 7:141577443-141577465 CCTAAGTTCAGCTAAAGACAGGG + Intronic
1033865569 7:145687096-145687118 CCTTAGTTCAGTTAAAAACCAGG - Intergenic
1033866224 7:145692952-145692974 CCTTAGTTCAGCTAAAAACCAGG - Intergenic
1034125976 7:148671963-148671985 CCTTAGTTCAGCTAAAATCTGGG + Intergenic
1035762156 8:2076625-2076647 CTTTAATTCTGCTAAAGCCAGGG - Intronic
1035924934 8:3717487-3717509 CCTTAGTTCAGCTAAAAACAGGG + Intronic
1036084536 8:5599390-5599412 CATTAGTTCAGCTAAAGACGGGG + Intergenic
1037110954 8:15164156-15164178 CCTTAGTTCAGCTGAAGACACGG - Intronic
1038405613 8:27320285-27320307 CCTTAGTTTAGCTAAAGACGGGG - Intronic
1038433067 8:27515281-27515303 CCTTAGTTCAGCTGAAGACGGGG - Intronic
1038704873 8:29884245-29884267 CCTTAGTTCAGCTAAGGATGAGG + Intergenic
1038864980 8:31429857-31429879 CCTTAGTTCAGCTAAGAGCCGGG - Intergenic
1039352606 8:36779451-36779473 CCTTAGTTCGGCTAAAGACGGGG - Intergenic
1039391690 8:37185975-37185997 CCTTAGTTCAGCTAAAAATGGGG - Intergenic
1039757642 8:40540409-40540431 CTTTAGTTCAGCTAAAGATGGGG - Intronic
1040424574 8:47272705-47272727 CCTTAGTTCAGCTAAAATCTGGG + Intronic
1040758014 8:50804526-50804548 CCTTAGTTCAGCTAAAGGCAAGG - Intergenic
1040758547 8:50809442-50809464 CCTTAGTTCAACTAAATATGAGG - Intergenic
1040990907 8:53348147-53348169 CCTTAGTTCAGCTAAAGACAAGG - Intergenic
1041146852 8:54885207-54885229 CCCTAGTTCCGCTAAAGATGGGG + Intergenic
1042415572 8:68514041-68514063 CCTTAGTTCAGTTAAAGATGAGG + Intronic
1042451694 8:68954920-68954942 CCTTAGTTCAGCTGAAAGCCAGG - Intergenic
1042579168 8:70257591-70257613 CCTTAGTTTAGCAAAGCACAGGG - Intronic
1043983095 8:86662873-86662895 CCTTAGTTCAGCTAAAGACAGGG - Intronic
1044288739 8:90442170-90442192 CCTTAGTTCAACTGAGGTCATGG + Intergenic
1044517570 8:93156886-93156908 CTTTAGTTCAGCTAAAATCTGGG - Intronic
1045201756 8:99990472-99990494 CCTTCGTTCAGCTAAAGACTGGG - Intronic
1046066442 8:109202683-109202705 CCTTAGTTCAGCTAAAGATAAGG + Intergenic
1046259035 8:111741564-111741586 CCTTAGTTCTGCTAAAGACGAGG - Intergenic
1046412150 8:113859473-113859495 CCTTAGTTCAGCTAAAATCTGGG - Intergenic
1047702509 8:127463659-127463681 GTTTAGTTCACCTAAAGACTTGG - Intergenic
1048649091 8:136454287-136454309 CCTTAGTTCAGCTAAGAGCCGGG - Intergenic
1048682009 8:136853616-136853638 CCTTAGTTCAGCTAAAGGCGGGG + Intergenic
1048742715 8:137579984-137580006 CCTTAGTTCAGCTAAAAGCCAGG + Intergenic
1048788903 8:138082212-138082234 CTTTAGTAGAGCTAAAAACATGG - Intergenic
1050510049 9:6384713-6384735 CCTTAGTTCAGCTAAGGATGGGG + Intergenic
1051014640 9:12460276-12460298 CCTTAGTTCAGCTGAAGATGAGG + Intergenic
1052059237 9:23940980-23941002 CCTTAGTTCAGCTAAAATCTGGG + Intergenic
1052230559 9:26145904-26145926 CCTTAGTTCATCTAAAGATGGGG + Intergenic
1052421982 9:28254090-28254112 CCTTAGTTCAGCTAAAGACGGGG - Intronic
1052616699 9:30851436-30851458 TCTTGGTTCAACTAAAGACAGGG - Intergenic
1052693601 9:31848837-31848859 CCTTAGTTCCGTTAAAGACGGGG - Intergenic
1054771315 9:69086703-69086725 CCTTAGTTCAGCTAAAGAGAAGG - Intronic
1055686198 9:78777745-78777767 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1056035039 9:82595477-82595499 CCCTAGTTCAGCAAAATAAAGGG - Intergenic
1056520397 9:87395779-87395801 CCTTAGTTCAGCTAAAAACAGGG - Intergenic
1056570269 9:87808573-87808595 CCTTAGTTCAGCTAAAACCCAGG - Intergenic
1056935287 9:90911504-90911526 CCTTAGTTCAGCTAAAGACTGGG - Intergenic
1057174749 9:92988036-92988058 CCTTAGTTCAGCTAAAATCCGGG + Intronic
1057457975 9:95231627-95231649 CCCTAGTTCAGCTAAGGACGGGG - Intronic
1058142811 9:101375922-101375944 TTTTAGTTCAGCTAAAGATGTGG - Intronic
1058207255 9:102124426-102124448 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1058281889 9:103126798-103126820 CTTTAGTTCAGCTAAAAACCTGG + Intergenic
1058282449 9:103132181-103132203 TCTTAGTTCAGCTAAAAACTAGG + Intergenic
1058731688 9:107856612-107856634 CCTTAGCTCAGCTAAAGATGGGG + Intergenic
1059793176 9:117662872-117662894 ACTTGGTTCAGCTAAGGACAAGG + Intergenic
1059811055 9:117856140-117856162 CCTTAGTTCAGCTAAAAATGGGG + Intergenic
1185880029 X:3732582-3732604 CCTTAGTTCAGATAAAAGCCAGG + Intergenic
1185940095 X:4308167-4308189 CCGTTGTTCAGCTAAAGGCGGGG - Intergenic
1186056058 X:5650825-5650847 CCTCAGTTCAGCTAAAGATGGGG - Intergenic
1186068033 X:5787680-5787702 CCTTAGTTCAGCCAAAGACAAGG + Intergenic
1186825915 X:13340029-13340051 CCTTAGTTCAGCTGAAGACGGGG + Intergenic
1186939458 X:14489377-14489399 CCTTAATTCAGCTAAAGATGGGG + Intergenic
1188375269 X:29421147-29421169 CCTTAGTTCAGCTAGAAACCAGG + Intronic
1188869952 X:35360508-35360530 CCTTAGTCCAGCTAAAGATGGGG - Intergenic
1189152895 X:38726076-38726098 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1189621523 X:42845650-42845672 CCTTAGTTCAGCTGATGACGGGG + Intergenic
1190021426 X:46881420-46881442 CCTTAGTTAAGCTAAATTAAAGG + Exonic
1190490622 X:50979322-50979344 CCTTAGTTCAGCTAAAGATGAGG - Intergenic
1190491250 X:50984251-50984273 CCTTATTTCAGCTAAAGATGGGG - Intergenic
1191645051 X:63471022-63471044 CTTTAGTTCAGCTAAAAGCTGGG + Intergenic
1192595853 X:72407519-72407541 CCTTAGTTCAGCTAAAGATGGGG - Intronic
1192680989 X:73253979-73254001 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1193254393 X:79330033-79330055 CCTTAGTTCAGCTAAAGACGGGG + Intergenic
1193481263 X:82032184-82032206 TCTTAGTTTGGCTAAAAACAAGG - Intergenic
1194066235 X:89266109-89266131 CCTTAGTTCAGCTAAAGATGAGG + Intergenic
1194066865 X:89271544-89271566 CCTTAGTTCAGGTAAAGATGGGG + Intergenic
1194086969 X:89539554-89539576 CCTTAGTTGAGCTCAAGACTGGG - Intergenic
1194188438 X:90805374-90805396 CCTTAGTTCAGCTAAGGACAAGG + Intergenic
1194403091 X:93461864-93461886 CCTTAGTCCAGCTAAAGGCAGGG + Intergenic
1194662505 X:96642674-96642696 CCTCAGTTCAGTTAAAAACTGGG + Intergenic
1196520148 X:116662934-116662956 CCTTAGTTCAGCTAAAGATGGGG + Intergenic
1196520714 X:116667843-116667865 TCTTAGATCAGCTAAAGAAGTGG + Intergenic
1197062449 X:122196759-122196781 CCTTAGTTCAGCTAAAGACAAGG - Intergenic
1197283357 X:124564541-124564563 CCATTGTTCAGCTAAAGAAAGGG - Intronic
1197348719 X:125356987-125357009 CCTTAGTTCAGCTAAGAGCTGGG - Intergenic
1197365638 X:125562161-125562183 CCTTAATTCAGCTAAAGTTGGGG + Intergenic
1197366224 X:125567426-125567448 CTTCAGTTCAGCTAAAGATGGGG + Intergenic
1197388307 X:125827424-125827446 CCTTAGTTCAGCTAAAGACGGGG - Intergenic
1197425650 X:126294779-126294801 CCTTAGTTCAGCTAAAGGTGGGG + Intergenic
1197662968 X:129193772-129193794 CCTTGGTTCAGCTAAAGGGAGGG - Intergenic
1197837061 X:130705987-130706009 CCTTAGTTCAGCAAAGAACCAGG - Intronic
1198074994 X:133185514-133185536 CCTTAGTTCAGCTAAAGATGGGG - Intergenic
1198139319 X:133786846-133786868 CCTTAGTTCAGTTAAAAATCTGG - Intronic
1198498709 X:137220672-137220694 CCTTAGTACAGCTAAAAACGGGG - Intergenic
1198647345 X:138823551-138823573 CCTTAGCTCAGCTACAGATAGGG - Intronic
1198850601 X:140961932-140961954 CCTTGGTTCAGCTAAAACCTGGG - Intergenic
1199234327 X:145472697-145472719 CCTTGGTTCAGCTAAAGATAGGG - Intergenic
1199430114 X:147749150-147749172 CCTTAGTCGAGCTAAACACGGGG + Intergenic
1200258343 X:154597817-154597839 GCTCAGTTCAGCTAAAAACTGGG - Intergenic
1200416740 Y:2919671-2919693 CATTAGTTCAGCTAAAGACTGGG - Intronic
1200439623 Y:3195423-3195445 CCTTAGTTGAGCTCAAGACTGGG - Intergenic
1200535027 Y:4387272-4387294 CCTTAGTTCAGCTAAGGACAAGG + Intergenic
1200720406 Y:6600228-6600250 CCTTAGTTCAGCTAAAGATGAGG + Intergenic
1200721030 Y:6605703-6605725 CCTTAGTTCAGGTAAAGATGGGG + Intergenic
1200785836 Y:7259626-7259648 CCTTAGTTCAGATAAAAGCCAGG - Intergenic
1201309912 Y:12587636-12587658 CCTCAGTTCAGCTAAAATCCAGG - Intergenic
1201526328 Y:14938577-14938599 CCTTAGTTCATCTAAAAACAGGG - Intergenic