ID: 984432540

View in Genome Browser
Species Human (GRCh38)
Location 4:179666611-179666633
Sequence TCCTTAGTTCAGCTAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 66, 1: 150, 2: 203, 3: 202, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984432540_984432543 15 Left 984432540 4:179666611-179666633 CCTGTCTTTAGCTGAACTAAGGA 0: 66
1: 150
2: 203
3: 202
4: 219
Right 984432543 4:179666649-179666671 TGATACACCTTAAAGGCATATGG No data
984432540_984432542 8 Left 984432540 4:179666611-179666633 CCTGTCTTTAGCTGAACTAAGGA 0: 66
1: 150
2: 203
3: 202
4: 219
Right 984432542 4:179666642-179666664 GCAACAATGATACACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984432540 Original CRISPR TCCTTAGTTCAGCTAAAGAC AGG (reversed) Intergenic
900727672 1:4228449-4228471 TCCTTAGTTCAACTAAAAAATGG - Intergenic
900754562 1:4424729-4424751 TCCTTAGCTCAGCTAATGACGGG - Intergenic
906935489 1:50210874-50210896 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
909584621 1:77275595-77275617 TCCTTAGTTCAGCTAAAACGAGG - Intergenic
909601258 1:77464094-77464116 TGCTTAGTTCAGCTGAAGACAGG + Intronic
910131885 1:83917201-83917223 TTGTTAGGTCAGCAAAAGACAGG + Intronic
910189987 1:84585366-84585388 TCCTTAGCTTAGCTAAAACCTGG + Intergenic
910513642 1:88035559-88035581 TCCTTAGTTCAGCTAAATCCGGG + Intergenic
910607234 1:89100347-89100369 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
911265052 1:95733675-95733697 TCCTTCGTTTGGCTAAAAACAGG + Intergenic
911281320 1:95933060-95933082 CCCTTAGTTCAGCTAAATCTGGG + Intergenic
912080904 1:105934221-105934243 TCCTTAGTTCAGCTAAAGGTGGG - Intergenic
912111590 1:106349084-106349106 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
913025313 1:114832594-114832616 TCCTTAGTTCAGCTAAGAGGTGG + Intergenic
913103086 1:115587583-115587605 TCCTTAGTTCAGCTAAAACAGGG - Intergenic
913103652 1:115592974-115592996 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
913134848 1:115878250-115878272 TCCTTAGTTCAGCTAAAACCTGG - Intergenic
915104622 1:153525975-153525997 TCCTTAACTCAGCTAAATCCAGG + Intergenic
915656387 1:157364545-157364567 TCATTAGTTCAGCTAAAAATGGG + Intergenic
915823936 1:159056062-159056084 TCCTTTGTTCAGCTAAACATGGG + Intergenic
915824349 1:159058732-159058754 TCCTTATTTCAGCTAAAGACAGG + Intergenic
916324353 1:163540450-163540472 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
916638774 1:166703365-166703387 TCCTTAGTTCAGCTAAAATCAGG - Intergenic
917076718 1:171213851-171213873 TCCATAGTTCAACTAAAGTCGGG + Intergenic
917077266 1:171218472-171218494 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
917210094 1:172622296-172622318 CCCTTAGTTCAGCTAAAAATGGG - Intergenic
917267333 1:173235206-173235228 TCTTTAGTTCAGCTAAAATCTGG + Intergenic
917371280 1:174297240-174297262 TCTTTAGTTCAGCTAAAGACGGG + Intronic
917556524 1:176096128-176096150 TCCTTAGTTCAGCTAAAACCAGG - Intronic
917557232 1:176102347-176102369 TCCTTAGTTCAGCTAAAACTGGG - Intronic
918270264 1:182891533-182891555 TCCTTCCTTCAGCTGAAGAATGG + Intergenic
918704290 1:187641407-187641429 TCCTTAATTCAGCTAAAGACGGG - Intergenic
919102660 1:193113097-193113119 TCCCTAGTTCAGCTAAAGACGGG + Intergenic
919258509 1:195158052-195158074 TTCTTAGTTCAGCTAAAGATGGG + Intergenic
919280200 1:195481284-195481306 TCCTTAGTTTAGCTAAAGACGGG + Intergenic
920762662 1:208800392-208800414 TCCTTAGTTCAGCTAAAAGCCGG - Intergenic
921736579 1:218634640-218634662 TCCTTAGCTCAGCTAAAATCTGG - Intergenic
922002525 1:221494596-221494618 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
922086886 1:222357640-222357662 TCCTTAGTTCAGTTAAAAATGGG - Intergenic
922339414 1:224643593-224643615 TCCTTAGTTCAGCTAAAGATGGG + Intronic
922568286 1:226616316-226616338 TCCTTAGTTCAGTTAAAGATGGG + Intergenic
922865046 1:228852510-228852532 TCCTTAGTTCAGCTAAGAGCTGG - Intergenic
923003820 1:230029225-230029247 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
923414246 1:233739267-233739289 TTCTTAGTTCGGCTAAAACCAGG - Intergenic
923908532 1:238413257-238413279 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
923914386 1:238485832-238485854 TCCTTAGTTCAGCTGAAGACGGG + Intergenic
1063030057 10:2225562-2225584 TCCTAAGTTCAGTTAAAGACAGG + Intergenic
1063281388 10:4633104-4633126 TTCTTAGTTCAGCTAAAAGCCGG - Intergenic
1063306728 10:4909535-4909557 TTCTTAGTTCAGCTAAATCCCGG - Intergenic
1063307008 10:4911551-4911573 TCCTTAGCTCAGATAAATCCAGG - Intergenic
1063307434 10:4918164-4918186 CCCTTAGTTCAGCTAAATCCAGG + Intergenic
1064002451 10:11674808-11674830 TCCTTAGTTCAGCTTAATCTGGG - Intergenic
1064174981 10:13066963-13066985 TCCTTAGTTCAGCTAAAACTGGG - Intronic
1064175664 10:13072771-13072793 TCCTTAGTTCAGCTAAAACTGGG - Intronic
1064334188 10:14423515-14423537 TCCTTAGTTCAGCTAAGAGCTGG - Intronic
1064949925 10:20836853-20836875 TTCTTGGTTCAGCTAAAGACAGG - Intronic
1064960105 10:20954495-20954517 TCCTTAGTTCAGCTAAAGATGGG + Intronic
1065151248 10:22825736-22825758 TCCTTAGTTCAGCTAAAGATCGG + Intergenic
1065643810 10:27814046-27814068 TTCTTGGTTCGACTAAAGACAGG + Intronic
1065811037 10:29444076-29444098 TCCTTAGTTCAGCTAAAACTGGG + Intergenic
1066241429 10:33539496-33539518 TTCTTAGTTCAACTAAACTCTGG - Intergenic
1066242540 10:33552246-33552268 TCCTTAGTTAAGCTAAAAGCGGG + Intergenic
1066783709 10:38979502-38979524 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1066979139 10:42395798-42395820 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1067180080 10:43978857-43978879 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
1068372316 10:56132598-56132620 CCTTTAGTTCAGCTAAAAACAGG - Intergenic
1068377148 10:56195581-56195603 TCCTTAGTTTAGCTAAAACCAGG - Intergenic
1068417747 10:56745893-56745915 TTCTTAATTCAGCTAAAATCCGG - Intergenic
1068428367 10:56898123-56898145 TCCTTTGTTCAGCTAAATCTGGG + Intergenic
1068438304 10:57019047-57019069 TCTTTAGTTCAGCTAAACATGGG + Intergenic
1068810374 10:61249074-61249096 ACCTGAGTTGAGGTAAAGACAGG - Intergenic
1069016260 10:63432494-63432516 TCCTTAGTTCAGCTCCAGGCAGG - Intronic
1069103661 10:64356402-64356424 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1069197439 10:65570694-65570716 CCCTTAGTTCAGCTAAAGACTGG - Intergenic
1069316348 10:67108037-67108059 TCCTTATTTCAGCTAAAGATAGG - Intronic
1069490424 10:68856146-68856168 TCCTTAGTTCAGCTAAAGACGGG + Intronic
1070406261 10:76100215-76100237 TCCTTAGTTCAGCTAAAACCAGG + Intronic
1071012181 10:80952417-80952439 TCCTTAGTTCAGCGAAAGACGGG + Intergenic
1071044861 10:81361380-81361402 TCCTTAGTTCAGCTAAACACGGG - Intergenic
1071137728 10:82471065-82471087 TCCTTAGTTCAGCTAAAAACGGG + Intronic
1071555759 10:86600141-86600163 TCCTTAGTTCAGGTAAAGACAGG - Intergenic
1071907344 10:90188437-90188459 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1072015089 10:91338554-91338576 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1073574230 10:104608405-104608427 TCCTTAGTTCAGCTAAAAATAGG - Intergenic
1073574777 10:104613151-104613173 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1073664055 10:105510046-105510068 TCCTTAGTTCAGCTAAAAGCGGG + Intergenic
1073886308 10:108043934-108043956 TTCTTAGTTCAGCTAAAGATGGG + Intergenic
1073902858 10:108244129-108244151 TCCTTAGCTCAGCTAAGTTCAGG - Intergenic
1074665166 10:115714228-115714250 TCCTTAGTTCAGCTAAAAATGGG + Intronic
1075875304 10:125800958-125800980 TCCTTAATTCAGCTAAATCTGGG - Intronic
1076812304 10:132893625-132893647 TGCTCAGTTCAGCTAAAGACGGG - Intronic
1078535786 11:12172584-12172606 TCCTCAGTTCAGGTAAAAGCAGG + Intronic
1078700854 11:13681069-13681091 TCCTTAGTTCAGCTAAAACCAGG + Intronic
1078736975 11:14029413-14029435 TCCTTAGTTCAGCCAAAACCGGG + Intronic
1078774970 11:14385460-14385482 TCCTTAGTTCAGCTAAACTTGGG - Intergenic
1079749106 11:24173514-24173536 TCCTTAGTTCAGCTGAAACTGGG + Intergenic
1079884090 11:25964270-25964292 TCTTTAGTTCAGCTAAAGATGGG - Intergenic
1079888238 11:26016312-26016334 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
1081011636 11:37820477-37820499 TCCTTAGTTCAGCTAAAGAAGGG + Intergenic
1081154717 11:39676509-39676531 TCCATAGTTCGGCTAAAAATGGG + Intergenic
1081190617 11:40099782-40099804 TCCTTAGTTCATCTAAAGATGGG - Intergenic
1081544762 11:44062899-44062921 TCCTTAGTTCAGCTAAAACCGGG - Intergenic
1081779498 11:45700148-45700170 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
1082036829 11:47651797-47651819 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
1082211063 11:49501987-49502009 TCCTTAGTTTAGCAGAAGGCTGG - Intergenic
1082633326 11:55566493-55566515 TCCTTAGTTCAGCTAAAAACGGG + Intergenic
1082655932 11:55857120-55857142 TCCTTAGTTCAGCTAAGAGCTGG - Intergenic
1082659822 11:55895818-55895840 TCCTTAGTTCAGCTAAGAACTGG - Intergenic
1082735526 11:56851347-56851369 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1082747690 11:56984349-56984371 TCCTTAGTTCAGTTAAAGATGGG + Intergenic
1082944118 11:58740201-58740223 TCATGAGTTCAGCTAAATTCAGG - Intergenic
1083125648 11:60563489-60563511 TCCTTAGTTCAGCTAAAACTGGG + Intergenic
1084879791 11:72162858-72162880 TCCTCAGTTCAGCCAAAGACAGG + Intergenic
1085566534 11:77519777-77519799 TCCTTAGTTCAGCTAATACCAGG + Intronic
1085946465 11:81278594-81278616 TCCTTAGTTCAGCTAAAACAGGG - Intergenic
1085987548 11:81805250-81805272 TTCTTAGTTCAGCTAAATCTGGG - Intergenic
1086133629 11:83425077-83425099 TCCTTAGTTCAGCTAAAAATGGG + Intergenic
1086295976 11:85368976-85368998 TCCTTCGTTTAGCTAAAGATGGG - Intronic
1086638582 11:89123053-89123075 TCCTTAGTTTAGCAGAAGGCTGG + Intergenic
1087127251 11:94640254-94640276 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1087258291 11:95981219-95981241 TCCTTAGTTCAGCTAAAACCAGG - Intronic
1087470061 11:98561734-98561756 TCCTTAGCTCAGCTAAAATATGG - Intergenic
1087485831 11:98758838-98758860 CCCTTATTTCAGCTAAAGATAGG - Intergenic
1087486717 11:98765582-98765604 CCCTTAGGTCAGCTAAAGACAGG - Intergenic
1087492798 11:98849216-98849238 TCCTTAGTTCACCTAAAATTCGG - Intergenic
1087716781 11:101617677-101617699 TCCTTAGTTCAGCTGAAGACAGG + Intronic
1088010511 11:104995238-104995260 TCCTTAGTTCAGCTAAAGATGGG - Intronic
1088559337 11:111097106-111097128 TCCTTAGTTCAGCTAAAACCGGG + Intergenic
1090196678 11:124822387-124822409 TCCTTAGTTCAGGTAAAAACGGG - Intergenic
1090487550 11:127127571-127127593 TCCTTAATTCAACTAAAGGCGGG + Intergenic
1090706797 11:129344980-129345002 TCCTTAGTTCAGCTAAAACCGGG - Intergenic
1091019751 11:132088399-132088421 TCCTTAGTTCAGCTGAATCCCGG + Intronic
1091115242 11:133006397-133006419 TTTTCAGTTCAGCTAAAGATGGG - Intronic
1091518596 12:1212553-1212575 TTCTTAGTTCAGCTAAAGACGGG + Intronic
1091670538 12:2449170-2449192 TCCTTAAGTCAGCTGAAGACAGG + Intronic
1091853086 12:3716517-3716539 TCGTTAGTTCTGTTAAACACTGG + Intronic
1091868102 12:3860375-3860397 TCCTTGGTTCAACAAAAGAAGGG + Intronic
1092454926 12:8634632-8634654 TCCTTATTTCATCCAAAGCCAGG + Intergenic
1092564427 12:9649427-9649449 TCCTTATTTCAGCTAAAAATGGG + Intergenic
1093922040 12:24869517-24869539 TCCTTAGTTTAGCTAAAGATGGG - Intronic
1093983147 12:25497465-25497487 TCCTTAGTTTAGCTAAAGACGGG - Intronic
1094390067 12:29939664-29939686 TCCTTAGTTCAGCTAAATATGGG + Intergenic
1094640820 12:32273721-32273743 TCCTTAGTTCAGCTAAAACCGGG + Intronic
1094716656 12:33020829-33020851 TCCTTAGTTCAGCTAAATCTGGG + Intergenic
1095157794 12:38879411-38879433 TCCTTAGTTTGGCTAAAGACAGG - Intronic
1095345249 12:41142301-41142323 TCCTTAGTTCAGCGAACATCTGG + Intergenic
1095813115 12:46392591-46392613 TCCTTAGTTCAGCTGAAGATGGG + Intergenic
1097419617 12:59358233-59358255 TCCTTAGCTCAGCTAAATCCAGG - Intergenic
1097812270 12:64032045-64032067 TCCTTAGTTCAACTAAAGACAGG + Intronic
1098435931 12:70468258-70468280 TCCTTATTTCAGCTAAAGATGGG - Intergenic
1098436911 12:70477174-70477196 TCCTTAGTTTAGCTAAGGATGGG - Intergenic
1098724980 12:73952372-73952394 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
1098805397 12:75015850-75015872 TCCTTAGTTTAGCTAAAGACAGG + Intergenic
1098805961 12:75020358-75020380 TCCTTAGTTTAGCTAAAGACAGG + Intergenic
1099150654 12:79108955-79108977 TCCTTAGTTCAGCTAAAGATGGG + Intronic
1099188122 12:79537986-79538008 TCCAAAGTTCAGCGAAAGAGAGG - Intergenic
1099534492 12:83827704-83827726 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1099812205 12:87597328-87597350 TGCTTAGTTCAGCTAAAAATGGG - Intergenic
1100233513 12:92634168-92634190 TCCTTAGTTCAGCTAAAATCCGG + Intergenic
1100271592 12:93030155-93030177 TCCTTAGTTCAGCTAAGAGCCGG - Intergenic
1100272204 12:93037269-93037291 TCCTTAGTTCAGCTAAAACCAGG + Intergenic
1100361621 12:93884755-93884777 TCCTTAGTTCAGCTAAAACCAGG - Intronic
1100716026 12:97306675-97306697 TCCATGGGTCAGGTAAAGACAGG - Intergenic
1101019623 12:100540237-100540259 TCTTTAGTCAAGCTAAAGAACGG - Intronic
1104220357 12:126776627-126776649 TCCTTAGCACAGCTAAAACCTGG - Intergenic
1104466573 12:128995275-128995297 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
1104574984 12:129958467-129958489 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
1105833865 13:24191881-24191903 TCCTTAGTTCAGCTAAAACCGGG + Intronic
1106074275 13:26444066-26444088 TTCTAAGTTTAGCTAAAAACTGG + Intergenic
1106617189 13:31340507-31340529 CCCTTAGTTTAGATAAAGACAGG - Intergenic
1107104009 13:36624183-36624205 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1107125036 13:36837672-36837694 TCCTTAGTTCAGCTAAATCTGGG + Intergenic
1107255957 13:38427198-38427220 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1107623551 13:42259152-42259174 CCCTTAGTTCAGCTAAATTCGGG - Intergenic
1107911381 13:45108694-45108716 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
1108000305 13:45900178-45900200 TCCTTAGTCCAGCTAAAAACAGG + Intergenic
1108584510 13:51858629-51858651 TCCTTAGCTCAGCTAAAAACCGG + Intergenic
1108711598 13:53038308-53038330 GCCATAGGTCAGCTAAAGACAGG + Intronic
1109012538 13:56970133-56970155 TCCTCAGTTCAGCTAAAGATGGG - Intergenic
1109389228 13:61671205-61671227 ACCTTAGTTCAGCTAAAGACGGG + Intergenic
1109482692 13:62976883-62976905 TATTTACTTCAGCTAAAGAGAGG + Intergenic
1109526807 13:63586474-63586496 TCCTTAGTTCAGCTAAAAACGGG + Intergenic
1109561143 13:64052285-64052307 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1109744933 13:66612920-66612942 TCCTTAGTTCAACTAAAGATGGG - Intronic
1109865330 13:68257061-68257083 TACTTAGTTCGGCTAAGGATGGG - Intergenic
1109865883 13:68261703-68261725 TCCTTAGTCCAGCTAAAGACGGG - Intergenic
1110256620 13:73440450-73440472 TCCTTAGTTCAGTCAAGGACAGG - Intergenic
1110413339 13:75226575-75226597 TCCTTGGTTCAGCTAAAGACGGG - Intergenic
1110524632 13:76521942-76521964 TCCTTAGTTCAGCTAAAACCGGG + Intergenic
1111132564 13:83996346-83996368 TCCTTAGTTCAGATAAAGATGGG - Intergenic
1111133116 13:84000895-84000917 TTCTTAGGTCAGTTAAAGATGGG - Intergenic
1111562271 13:89966903-89966925 TCCTTATGTCAGCTAAAGATGGG - Intergenic
1111727496 13:92030965-92030987 TTCTTAGCTCAGCTAAAAACAGG - Intronic
1112015382 13:95327116-95327138 TCCTTAGTTCATCTAAAAACGGG - Intergenic
1112065005 13:95783754-95783776 TCCTTAGTTCAGCTAAAGACAGG + Intronic
1112192485 13:97191484-97191506 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1112286027 13:98105146-98105168 TCCTTAGTTGAGCTAAAGCCAGG + Intergenic
1112957031 13:105073006-105073028 TCCTTAGTTCATCTAAAACTGGG + Intergenic
1113972855 13:114203503-114203525 TCCTTAGTTCAGCTGAAACTGGG + Intergenic
1114440922 14:22747134-22747156 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
1115549888 14:34495555-34495577 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1115898452 14:38117816-38117838 TCCTGAGTTCAGCTACATCCTGG - Intergenic
1116055790 14:39862535-39862557 TCCTTAGTTCAGCTAAAGGTGGG + Intergenic
1116102837 14:40464321-40464343 TCCTTAGTTCAGCTAAAATCCGG - Intergenic
1116256381 14:42561994-42562016 TCCTTAGTTCAGCTAAAACCGGG + Intergenic
1116369259 14:44109059-44109081 TTCTTAGTTCAGCTAAATCTGGG - Intergenic
1116389835 14:44379284-44379306 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1116390439 14:44384523-44384545 TCCTTAGTTGAGTTAAAGACGGG + Intergenic
1116599625 14:46903236-46903258 TCCTTAGTTCAGCTAAATCTGGG - Intronic
1117057393 14:51926856-51926878 TCCTTAGTTCAGCTAAAAACGGG - Intronic
1117285019 14:54278511-54278533 TCCTTAGTTCAGCTGAAGATAGG - Intergenic
1117289323 14:54317042-54317064 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
1117938533 14:60935858-60935880 TCCTTAGTTCAGCTAAAACCGGG + Intronic
1118395806 14:65335529-65335551 TCCTTAGTTCAACTAAAAGCCGG + Intergenic
1118999048 14:70864967-70864989 TCCTTAGTTCAACTAAATCCAGG + Intergenic
1119128747 14:72152796-72152818 TCCTTAGTTTAGCTAACATCTGG + Intronic
1119559330 14:75578161-75578183 TCTTTAGTTCAGCAAAGGGCTGG + Intergenic
1120320603 14:82956049-82956071 TCCATAGTTCAGCTAAAGATGGG + Intergenic
1120477030 14:85001716-85001738 CCCTTAGTTTAGCTAGAGACGGG + Intergenic
1120571972 14:86129820-86129842 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1120952717 14:90057207-90057229 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1120969615 14:90196436-90196458 TCCTTAGTTCAGCTAAAACCGGG - Intergenic
1121486248 14:94317646-94317668 TACTTAGTCCAGCTAAACACGGG - Intronic
1122641482 14:103162306-103162328 TCCTTAGTTCAGCTAAATCCAGG + Intergenic
1123777619 15:23596610-23596632 TCCTTAGTTCAGCTAAAACCAGG + Intronic
1126145790 15:45471642-45471664 TCCCTAGTTAAGCTACAGGCAGG - Intergenic
1126428897 15:48559580-48559602 TCCTTAGTTCACATAGACACAGG - Intronic
1126497668 15:49310191-49310213 TCCATATTTCTGCTAATGACAGG + Intronic
1126570598 15:50146647-50146669 TCCTTAGTTCAGCTAAAGACAGG + Intronic
1126666186 15:51077975-51077997 CCCTTAGTTCAGCTAAAACGGGG - Intronic
1127348291 15:58124275-58124297 TCCTTAGCTCAGCTAAAAACGGG + Intronic
1128101808 15:65007290-65007312 TCCTTAACTCAGCTAAAATCTGG - Intronic
1128534715 15:68481753-68481775 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1128920147 15:71603166-71603188 TCCTTGGTTCAGCTAAAACCAGG + Intronic
1131817182 15:96233916-96233938 TCCTTAGTTCAGCTGAAATAGGG - Intergenic
1132505040 16:303775-303797 TGCTTAGTTCAGCTAAAAACAGG - Intronic
1135077051 16:19402805-19402827 TCTTTAGTTCAGCTAAAGATGGG + Intergenic
1135077598 16:19407547-19407569 TCCTTAGTTCAGCTAAAGATAGG + Intergenic
1135669698 16:24364783-24364805 CCCTGAGTTCAGCTGAAGGCCGG + Intergenic
1135788180 16:25368969-25368991 TCCTTAGTTCAGCTAAAATCTGG - Intergenic
1137330746 16:47492875-47492897 TCCTTAGTTCACCTAAAAATGGG + Intronic
1137815921 16:51397444-51397466 TCCTTAGTTTAGCTAAAAATGGG + Intergenic
1138174554 16:54884723-54884745 TCCTTAGTTCAGCTAAAAACGGG - Intergenic
1138864053 16:60795045-60795067 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1138975447 16:62201893-62201915 ACTTTAGTTCAGCTAAAGACAGG + Intergenic
1139029286 16:62859940-62859962 ACCTTAGTTCAGCCAAAAACGGG + Intergenic
1140691051 16:77484188-77484210 TCCTTATTTAAGCTAGACACTGG - Intergenic
1140742438 16:77953376-77953398 TGATTAGTTTAGCTCAAGACTGG + Intronic
1141138007 16:81479068-81479090 TCTTTAGTTCTGCTATTGACCGG + Intronic
1142868919 17:2808181-2808203 TCCTGAGCTCAGCTCAAAACGGG - Intronic
1143790550 17:9291981-9292003 TCCTTAGTTCAACTAAGGCAAGG - Intronic
1144143756 17:12377057-12377079 TCCTTAGTTCAGCTAAAACCAGG + Intergenic
1144228559 17:13175663-13175685 TCCTTAGGTCAGCTAAAATCTGG - Intergenic
1144334060 17:14253323-14253345 TCCTTAGCTCAGCTAGATCCAGG - Intergenic
1145405282 17:22584973-22584995 TCCTTAGTTCAGTTAAAGATGGG + Intergenic
1149056832 17:52376549-52376571 TCCTTAGTTCAGCTAAATCCAGG - Intergenic
1149094454 17:52824481-52824503 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
1149107614 17:52988199-52988221 TCCTCAGTTCAGCTAAAAGCTGG - Intergenic
1150195591 17:63294886-63294908 TCCTTAGCTCAGCTATAGTTGGG + Intronic
1150595773 17:66603064-66603086 TCTTTAGTTCAGCTAAAAGCCGG - Intronic
1150839173 17:68591974-68591996 TCCTTAGTTCAGCTAAAACTGGG - Intronic
1151997589 17:77619755-77619777 GCTAAAGTTCAGCTAAAGACGGG - Intergenic
1152009958 17:77706777-77706799 TCCTTAGATCAGCAAGAGAATGG + Intergenic
1152148908 17:78586747-78586769 TCCTTCATTCAGCTAAAACCAGG - Intergenic
1152534617 17:80943326-80943348 TTTTTAATTCAGCTAAAAACAGG + Intronic
1152902280 17:82949624-82949646 TTCTTAGTTCAGCTGAAGAATGG - Intronic
1153246106 18:3073962-3073984 TCCTTAGTTCAGCTAAATCCAGG - Intronic
1153577035 18:6532583-6532605 TCCTTAGTTCAGCTAAATCTGGG - Intronic
1153704162 18:7728255-7728277 TCCTTAGTTCAGCTAAATCTGGG + Intronic
1153704607 18:7732978-7733000 TCCTTAGTTCAGCTAAATCTGGG + Intronic
1155593414 18:27454251-27454273 TCCTTACTTCAGCTAAAGACGGG + Intergenic
1155606867 18:27616128-27616150 TCCTTAGTTCAGCTAAAAACGGG - Intergenic
1155623903 18:27812849-27812871 TCCTTAGTTCAGCTAAAACTGGG + Intergenic
1155784954 18:29884315-29884337 TCCCTAGTTCAGCTGAAGATGGG + Intergenic
1155797607 18:30059760-30059782 TCTTTAGTTCAGCTAAAAGCTGG + Intergenic
1156098034 18:33560639-33560661 TCCTCAGTTCAGCTAAAACTGGG + Intergenic
1156098670 18:33566547-33566569 TCCTTAGTTCAGCTAAAATCAGG + Intergenic
1156782426 18:40866674-40866696 TCTTTAGTTCAGTTAAAACCTGG - Intergenic
1156971506 18:43162727-43162749 TCCTTAGTTCAGCTAACGACTGG - Intergenic
1157821619 18:50775607-50775629 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1158152407 18:54387602-54387624 TCCTTAGTGCAGCTAAGAGCTGG + Intergenic
1158535853 18:58307420-58307442 TCCTTAGTTCAGCTTAAGAGGGG - Intronic
1158639204 18:59188992-59189014 TCCTTAGTTCAGCTCAATCCAGG + Intergenic
1158641543 18:59207899-59207921 TCCTTAGCTCAGCTAAAGTCAGG - Intergenic
1159134868 18:64326153-64326175 TCCTTAGCTCAGCTAAAGACGGG + Intergenic
1159309207 18:66686563-66686585 TCCTTAGTTCAGCTAAATCCAGG - Intergenic
1159310932 18:66707693-66707715 TCCTTAGTTCCCCTAAAAGCCGG - Intergenic
1159481969 18:69001389-69001411 TCCTTAGTTCAGCTAAAGACAGG + Intronic
1159539345 18:69755780-69755802 TCCTTAGTTCAGCTAAATCCAGG + Intronic
1159655096 18:71023815-71023837 TCCTTAGTTTAGCGAAAGATGGG + Intergenic
1159783963 18:72692519-72692541 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1159784634 18:72698096-72698118 TCCTTAGTTCAGCTACAGACGGG - Intergenic
1160259658 18:77280458-77280480 TTCTGAGTTCAACTAAACACAGG - Intergenic
1164406812 19:27955881-27955903 TCCTTAGTTCAGCTAAAACCAGG - Intergenic
1167393275 19:49210890-49210912 TCCTGACTTCAGCTGAAGGCAGG + Intronic
1202640852 1_KI270706v1_random:84791-84813 TCCTTAGTTCAGCTACATCTGGG - Intergenic
925066628 2:932817-932839 TCCTTACTTCAGAGAAAGAAGGG - Intergenic
925160675 2:1681401-1681423 TCCCTAGTTCAGCGAAAGATGGG - Intronic
925538478 2:4941162-4941184 GTCTTAGTTCATCTAAAGACGGG + Intergenic
926344423 2:11932267-11932289 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
926838902 2:17056626-17056648 TCCTTAGTGCAGCTAAAAACGGG - Intergenic
926888922 2:17622650-17622672 TCCTTAGCTCAGCTAAAACCAGG + Intronic
927045340 2:19272523-19272545 TCCTTACTTCAGCTAAAGATGGG - Intergenic
928079823 2:28300942-28300964 TACTCAGTTCAGCTGAAGAATGG - Intronic
928182918 2:29082432-29082454 TCCTTAGTTCAGTTAAAGACGGG + Intergenic
928833404 2:35516757-35516779 TCCTTAGTTCAACTAAAATCTGG + Intergenic
928959165 2:36905860-36905882 TTCTTAGTCTAGTTAAAGACAGG - Intronic
929115740 2:38442399-38442421 TCCTTAGTTCAGCTAAGAGCTGG - Intergenic
930545421 2:52761556-52761578 TTCTTAGTTCAGCTAAAGACAGG + Intergenic
930630719 2:53752265-53752287 TCCTTAGTTCAGCTAAAATCCGG + Intronic
930980915 2:57524636-57524658 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
931471011 2:62537601-62537623 TGCTTAGTTCAGCTAAAACCAGG - Intergenic
931793670 2:65689289-65689311 TCCTTACTTTAGATATAGACTGG - Intergenic
931938700 2:67228451-67228473 TCCTTAGTTCAGCTGAAGATGGG + Intergenic
932831916 2:74998528-74998550 TCCTTAGTTCAGCTAAAATCCGG + Intergenic
933061831 2:77747638-77747660 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
933071045 2:77858092-77858114 TTCTTAGTTCAGCTAAATATGGG - Intergenic
933130764 2:78672445-78672467 TTCTTAGTTCATCTACAGATGGG + Intergenic
933131411 2:78677738-78677760 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
933495054 2:83040347-83040369 TCCTTAGTTCAGCTGAAAGCTGG + Intergenic
933495501 2:83045904-83045926 TCCTTAGTTCAATTAAAAGCTGG + Intergenic
934496417 2:94804779-94804801 TCCTTAGTTCAGCTCAATCTGGG - Intergenic
934932411 2:98437183-98437205 TCCTTAGTTCCCCTAAACTCTGG - Intergenic
935597283 2:104889191-104889213 TCCTTAGTTCAGCTAAGAGCCGG + Intergenic
935724493 2:106011162-106011184 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
936578648 2:113676298-113676320 CCCTTAGTTCAGCTAAGAGCTGG - Intergenic
936639621 2:114297638-114297660 TCCTTAATTCAGCTAAAAACAGG + Intergenic
936840219 2:116758950-116758972 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
937153086 2:119699406-119699428 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
937602372 2:123754376-123754398 TCCTTAGTTCAGCTAAAGGCAGG + Intergenic
937648992 2:124298963-124298985 TCCTTAGTTTAGCTAAACATGGG + Intronic
937727516 2:125185675-125185697 TCCTCAGTTCAGCTAAATACGGG + Intergenic
937727810 2:125187738-125187760 TCCTTAGTTCATCTGAAGACTGG + Intergenic
938618047 2:133020184-133020206 ATCTTTGTTCAGCTAAAGACAGG + Intronic
938705132 2:133917088-133917110 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
939127396 2:138193742-138193764 TCCTTAGTTCAGCTAAATCTGGG + Intergenic
939582200 2:143963814-143963836 TCTTTATTTCAGCAAAGGACTGG + Intronic
939840356 2:147180826-147180848 TCCTTAGTTCAGCTAAAAACGGG + Intergenic
940189954 2:151030605-151030627 TCCTTAGTTCGGCTAAAGATGGG + Intronic
940391128 2:153133569-153133591 TCCTCAGTTCAGCTAAAAACCGG - Intergenic
940624013 2:156150041-156150063 CCTTTAGTTCAGCTAAAAACAGG + Intergenic
941249970 2:163148945-163148967 TCCTTAGTTCAGCTGACAGCTGG - Intergenic
941262550 2:163316041-163316063 TCCACAGTTCAGCTAAATCCAGG + Intergenic
942109256 2:172663871-172663893 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
942900994 2:181118254-181118276 TCCTTATTTTAGCCAAAGAAAGG - Intergenic
943109994 2:183592793-183592815 TCCTTAGTTCAGCTAAAATCGGG - Intergenic
943214443 2:185012804-185012826 TCCTTAGTTCAGCTGAAGATGGG - Intergenic
943246316 2:185455888-185455910 TCCTTAGTTCAGTTAAAATTGGG - Intergenic
943258509 2:185628865-185628887 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
943258726 2:185630510-185630532 TTCTTAGTTCAGCTAAAGATGGG + Intergenic
943420173 2:187659477-187659499 TCCTTAGTTCAGCTAAAAACAGG - Intergenic
943846500 2:192655865-192655887 TCCTTTGTTCAGCTAAAACCAGG + Intergenic
943905853 2:193501027-193501049 TCCTTAGTTTAGCTAAAGATGGG + Intergenic
943927120 2:193799450-193799472 TCTTTAGTTCAGCTAAATTGGGG + Intergenic
944087725 2:195869016-195869038 TCCTTAGTTCAGCTAAAGGTGGG + Intronic
944964431 2:204914322-204914344 TCTTTAGTTCAGCTAAAAACGGG - Intronic
945217283 2:207447085-207447107 CCCTTGGTTCAGCTAAAAGCTGG - Intergenic
945561593 2:211347167-211347189 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
945631928 2:212288712-212288734 TCTTTAGTTGAGCTAAAAACGGG - Intronic
946439783 2:219685475-219685497 TCCTTAGTTCAGCTAAAAACGGG - Intergenic
946752073 2:222902581-222902603 TCCTTAGTTCAGCTAAATCCAGG + Intronic
946885415 2:224217594-224217616 TCCTTAGTTCAGCTAAATACAGG - Intergenic
947227811 2:227857199-227857221 TCCTTAATTCAGCTGAAGATGGG + Intergenic
948732124 2:239972372-239972394 TCCTTAGTGCATCTAGAGAGAGG - Intronic
1169699646 20:8432083-8432105 TCCTTAGTTCAGCTGAAGACAGG + Intronic
1169731192 20:8787071-8787093 TCCTTAGTTCAGCTAAAGACGGG + Intronic
1169780694 20:9306898-9306920 TCCTTAGTTCAGCTAAAAACAGG + Intronic
1170035781 20:11988190-11988212 TCCTAAGTGCAGCTACATACTGG + Intergenic
1170222384 20:13953817-13953839 TCCTTAGTTCAGCTAAAAACAGG - Intronic
1170335721 20:15268009-15268031 TCCTCAGTTCAGCTAAAAACTGG - Intronic
1170877869 20:20267646-20267668 TCCGTAGTTCAGCTAAAGATGGG + Intronic
1171358227 20:24567070-24567092 TCCTTAGTTCAGCTAAAGACAGG + Intronic
1172365235 20:34343969-34343991 TCCTTAGTTCAGCTAAAACCAGG - Intergenic
1176886475 21:14261582-14261604 TCCTTAGTTCAGCTAAAAATTGG - Intergenic
1176972301 21:15280915-15280937 TCCTTAGTTCAGCTAAAAGCTGG + Intergenic
1177192396 21:17866559-17866581 TCCTTAGTTCAGCTAAAGAGGGG + Intergenic
1177305258 21:19306838-19306860 CCCTTAGTTCAGCTAAAGATGGG - Intergenic
1177405567 21:20663176-20663198 TCCTTAGTTCAGCTTAAATGGGG - Intergenic
1177543179 21:22521408-22521430 TCCTTAGTTCATCCAAAAACAGG - Intergenic
1177567996 21:22848181-22848203 TCCTTAGTTCAGCTAAAATCTGG + Intergenic
1177900930 21:26914193-26914215 TCCTTAGCTCAGCTAGGTACGGG - Intergenic
1178062920 21:28872124-28872146 TCCTTAGTTCAGTTAAATTTGGG + Intergenic
1178620088 21:34166682-34166704 TCTTTAGTTCAGCTAAAGGTGGG + Intergenic
1179140511 21:38721032-38721054 TCCTTAGTTCAGCTAAAACCAGG + Intergenic
1179956225 21:44740663-44740685 TCCTTAGCTCAGCTAAAACCTGG - Intergenic
1179956943 21:44746180-44746202 TCCTTAGCTCAGCGAAAACCTGG - Intergenic
1180361100 22:11897071-11897093 TCCTTAGTTCAGCTACATCTGGG + Intergenic
1181151860 22:20889894-20889916 TCATCAGTCCAGCAAAAGACAGG - Exonic
1181453950 22:23044500-23044522 CTCTTAGTTCAGCTAAAGATGGG + Intergenic
1183114661 22:35681595-35681617 TCCTTAGTTCAGCTAAATCCAGG + Intergenic
1184043698 22:41958944-41958966 TCCTCATTTCAGGAAAAGACAGG - Intergenic
949166923 3:954205-954227 GCCTTAGTTCAGCTAAAACCTGG + Intergenic
949307434 3:2658384-2658406 TCCTTAGCTCAGCTAATGATGGG - Intronic
949571629 3:5299574-5299596 TCCTTAGTTCAGCTAAAAGTCGG + Intergenic
949785221 3:7733209-7733231 TCCTTATTTCAGTTAAATCCAGG + Intronic
949811895 3:8015475-8015497 TCCTTAGTTCAGCTAAAAATGGG + Intergenic
949812511 3:8021003-8021025 TCCTTAGTTCAGCTAAAAACAGG + Intergenic
950632386 3:14291146-14291168 TCCTTAGTCCAGCTAACAGCCGG - Intergenic
951193754 3:19802098-19802120 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
951345465 3:21542926-21542948 TCCTTCCTTCATCTGAAGACTGG - Intronic
951346129 3:21548209-21548231 TCCCTAGTTCAGTTAAAGACTGG - Intronic
951821767 3:26821753-26821775 TCCTTGGTGCAGCTAAAGTCAGG + Intergenic
951829842 3:26914444-26914466 TGCTTAGTTGAGCTAGAGACAGG + Intergenic
951845388 3:27079354-27079376 TCCTTAGTTCAGCTAAAACCAGG + Intergenic
951961149 3:28322582-28322604 TGCTTCCTTCAGCTAAAGCCTGG + Exonic
952080082 3:29747601-29747623 TCCTTAGTTCAACTAAATCTGGG + Intronic
952193479 3:31047713-31047735 TCCTTAGCTCAGATAAAGATAGG - Intergenic
952636986 3:35544870-35544892 TCCTCAGTTCAGCTAAAAACTGG + Intergenic
953436997 3:42885578-42885600 TCCTTAGTTCAGCTAAAATCTGG + Intronic
953441089 3:42918212-42918234 TCCTTAGTTCAGCTAAAATCTGG + Intronic
954598271 3:51846030-51846052 TCCTTAGTTCAGCTAAAAATGGG + Intergenic
954968641 3:54633407-54633429 TCCTTAGCTCAGCTAAAGACAGG + Intronic
955574234 3:60341892-60341914 TCCTTAGTTCAGCCAAAACGAGG + Intronic
955574614 3:60346679-60346701 TCCTTAGTTCAGCTAAAACTGGG - Intronic
955612798 3:60775586-60775608 TCCATAGTTCAGTTAAAGACAGG - Intronic
955613437 3:60781041-60781063 TCCTTAGTTCAGCTAAAGAGAGG - Intronic
956247725 3:67203017-67203039 ACTTTAGTGCAGCTAAAGATGGG - Intergenic
956282620 3:67573871-67573893 TCCTTAGTTCAGCTAAAGATGGG - Intronic
956286132 3:67612685-67612707 TCCTTACTTCAGCTGAAGTTAGG + Intronic
956656381 3:71556857-71556879 TATTTATTTCAGCAAAAGACTGG + Intronic
957288414 3:78246608-78246630 TCATTAATTCAGCTAAAGATGGG - Intergenic
957288755 3:78249730-78249752 TCCTTAGTTCAGCTAAAGGCAGG - Intergenic
957549876 3:81690018-81690040 TCCTTAGTTCAGCTAAATACAGG - Intronic
957574013 3:81986313-81986335 TCCTTAGTTTAGATAAAGACAGG - Intergenic
957574682 3:81991637-81991659 TCCTTAGGTCAGCTAAAGACAGG - Intergenic
957952744 3:87146094-87146116 CCCTTAATTCAGCTAAAGGTGGG - Intergenic
957986831 3:87582576-87582598 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
957990225 3:87617613-87617635 TTCTTAGTTCAGCTGAAGATGGG + Intergenic
958536219 3:95408047-95408069 TCCTTCATTCAGCTAAAATCAGG - Intergenic
958536724 3:95412909-95412931 TCCTTAGTTTAGCTAAAACTCGG - Intergenic
958974644 3:100653889-100653911 TCCTTTGTTCAGCTAAAAGCTGG + Intronic
959401990 3:105913968-105913990 TTCTTAGTTCAGCTAAAAATGGG - Intergenic
959623381 3:108422969-108422991 TCCTTAGTTCAGCTAAAGATGGG + Intronic
959632610 3:108525103-108525125 TCCTAATTTCAGCTAAAGATTGG + Intronic
959660570 3:108863703-108863725 TCCTTAGTTCAGCTAAAACCGGG + Intergenic
959820579 3:110730308-110730330 TATTTAGTTCAGCTGAAGACGGG - Intergenic
960842069 3:121969544-121969566 TCCTGAGTTCAGTTAAACTCAGG + Intergenic
962362852 3:134756197-134756219 TCCTGAGTTCAGGTTAAGATTGG + Intronic
963267466 3:143253629-143253651 TTCTTAGTTCAGCTAAATCTGGG + Intergenic
963433934 3:145244252-145244274 TACTTAGTTCAGCTACATTCTGG + Intergenic
964073067 3:152658942-152658964 TCCCTAGTTCAGCTAAAGATGGG + Intergenic
964304482 3:155325854-155325876 TTCTTAGCTCAGCTGAAAACAGG - Intergenic
964368098 3:155970802-155970824 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
964980425 3:162670611-162670633 TCCTTAGTTTAGCTAAAGACAGG - Intergenic
965027669 3:163324253-163324275 TCCTTAGTTCAGCTAAAGTTGGG - Intergenic
965028227 3:163329282-163329304 TCCTTAGTTCAGCTAAAGAAAGG - Intergenic
965224856 3:165975163-165975185 TCCTTAGTTCAGCTAAAAGCTGG + Intergenic
966298838 3:178455933-178455955 TCCTTAATTCAGTTAAAGATGGG + Intronic
966465581 3:180227949-180227971 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
966466542 3:180235904-180235926 TCCTTAGTTCAGTTAAATCCGGG - Intergenic
966523150 3:180894764-180894786 TCCTTCATTCAGCTAAAGATGGG - Intronic
966523887 3:180900450-180900472 TCCTTAGTTCAGCTAAAGATGGG - Intronic
967067894 3:185937295-185937317 TCCTTCGTTAACCTAAACACCGG + Intronic
967212799 3:187183663-187183685 CGCTTAGTTCAGCTAAAACCTGG - Intergenic
967256055 3:187593263-187593285 TCCTTAGTTTAGCTAAAAATTGG + Intergenic
967537256 3:190620753-190620775 TCCAGAGTACAGATAAAGACAGG - Intronic
968381594 4:101305-101327 TCCTTAGATCAGCTAAAACTGGG - Intergenic
969073772 4:4560992-4561014 TCCTGAGTTCAGCTAAAACCAGG + Intergenic
969190721 4:5516502-5516524 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
969903495 4:10371757-10371779 TCCTTAGTTCAGCTAAAACTAGG + Intergenic
970112267 4:12651530-12651552 TCCTTAGTTCATATATAGACAGG - Intergenic
970260366 4:14217842-14217864 TCCTTAGTTTAGCTAAAGATAGG - Intergenic
970721347 4:18992822-18992844 TCCTTAGTTCAGCTAAAATCTGG - Intergenic
971345394 4:25807408-25807430 TTCTTATTACAACTAAAGACTGG - Intronic
971364411 4:25966088-25966110 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
971711453 4:30118601-30118623 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
971811441 4:31432933-31432955 TCCTTAGCTCAGCTAAAATCTGG - Intergenic
971846442 4:31924612-31924634 TCCTTAGTTCAGCTATAGACGGG + Intergenic
971998309 4:33995366-33995388 TCTTCAGTTCAGTTAAAGATGGG - Intergenic
972555520 4:40177017-40177039 TCCTTAATTCCGCCAAAGAGGGG - Intergenic
973226492 4:47790549-47790571 TCCTTAGTTCACCTAAAAGCTGG - Intronic
973384368 4:49495322-49495344 TCCTTAGTTCAGCTACATCTGGG - Intergenic
974158998 4:58112905-58112927 TCCTTAGTTCAACTAAAGATGGG + Intergenic
974165467 4:58195778-58195800 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
974480033 4:62431424-62431446 TCCTTAGTTCAGTTAAAACTAGG + Intergenic
974665296 4:64953660-64953682 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
974674806 4:65076256-65076278 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
974963711 4:68735182-68735204 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
975182285 4:71360829-71360851 TCCTTAGTTCAGTTAAAGACGGG + Intronic
975222759 4:71832427-71832449 TCCTTAGTTCAGCTAAAAACAGG - Intergenic
975223147 4:71837867-71837889 TCATTAGCTCTTCTAAAGACAGG + Intergenic
975756741 4:77578758-77578780 TCCTTAGTTCAGCTAAAACTGGG - Intronic
976316343 4:83663375-83663397 TCCTTAGTTCAGCTGAAACTGGG + Intergenic
976344933 4:83989728-83989750 TCCTTAGTTCAGCTAAAAATGGG - Intergenic
976345458 4:83994360-83994382 TCCTTAGTTCAGCTAAAAACAGG - Intergenic
976690711 4:87864330-87864352 TCCTTAATTCAGCTAAAGGCAGG + Intergenic
976826259 4:89263649-89263671 TCCTTAGTTCAGCTAAAGATGGG - Intronic
977054556 4:92175224-92175246 TCCTTAGTTCAGCTAAAACTGGG + Intergenic
977352865 4:95910699-95910721 TGCTTAGTCCGGCTAAAGATGGG + Intergenic
977685612 4:99844065-99844087 TCCTTAGTTCAGCTAAAGATCGG + Intronic
977989316 4:103421517-103421539 TCCTTAGTTCAGCTAAAATCAGG - Intergenic
978227553 4:106355617-106355639 TCCTCGTTTCAGCTAAAAACTGG - Intergenic
978918096 4:114149309-114149331 TCCTTAGTTCAGCTAAATATGGG + Intergenic
979014677 4:115418683-115418705 TCCTTAGTTCAGCTAAATCCAGG - Intergenic
979015394 4:115425291-115425313 TCCTTAGTTCAGCTAAAGCTGGG - Intergenic
979105820 4:116685962-116685984 TCTTTAGTTCAGCTAAAGATGGG + Intergenic
980287473 4:130799140-130799162 TCCTTACTTCAGTTAAAATCCGG + Intergenic
980387844 4:132110413-132110435 TCCTTAGTTGAGCTAAAGACGGG + Intergenic
980571691 4:134627807-134627829 CCCTTAGTTGAGCTAAAGACAGG - Intergenic
980722489 4:136716674-136716696 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
980723051 4:136721517-136721539 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
980726649 4:136770110-136770132 TCCTTAGTTCAGCTAAATAGAGG - Intergenic
980795477 4:137676986-137677008 TTCTTAGTGCAGCTAAATCCTGG + Intergenic
980984512 4:139682762-139682784 TCCTTAGTTCAGCTAAAACTGGG + Intronic
981091101 4:140733345-140733367 TCCTTTGTTCAGCTGATGTCAGG + Intronic
981189992 4:141851416-141851438 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
981255463 4:142656306-142656328 TCCTTAGTTCTGCTACAGACGGG - Intronic
981256073 4:142661239-142661261 TTCTTAGTTCAGCTAAAGACTGG - Intronic
981324705 4:143432372-143432394 TCCTTAGTTCAGCTAAAACTGGG + Intronic
981456010 4:144954038-144954060 TCCTTAGTTCAGCTAAAACCAGG - Intergenic
981456906 4:144962899-144962921 TCTTTAGTTCAGCTAAAACCAGG - Intergenic
981770786 4:148304997-148305019 TCGTTAGTTCAGCTAAAACCTGG - Intronic
982404732 4:155007146-155007168 TCCTTATTTTAACTAAAGAAGGG - Intergenic
982475251 4:155842759-155842781 TCCTTAGTTCAGCTAAAACTGGG + Intronic
982526673 4:156487548-156487570 TCCTTAATACAGCTAAAATCTGG - Intergenic
982890096 4:160836198-160836220 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
983321158 4:166198442-166198464 TCCTTAGTTCAGTTAAAGACGGG - Intergenic
983321752 4:166203415-166203437 TCCTTAGTTCAGCTAAAGGTGGG - Intergenic
983862096 4:172720183-172720205 TCCTTAGTTCAGCTAATGACGGG + Intronic
984210715 4:176844371-176844393 TCTTTAATGCAGGTAAAGACAGG + Intergenic
984244999 4:177264215-177264237 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
984414902 4:179445969-179445991 TCATTAGTTCAGCTGAAAATGGG + Intergenic
984432540 4:179666611-179666633 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
984896890 4:184549009-184549031 CCCTTAGTTCAGCCAACCACGGG + Intergenic
985385963 4:189448476-189448498 TCCTTAGTTCAGGTAAAGACAGG - Intergenic
1202768219 4_GL000008v2_random:170646-170668 TCCTTAGTTCAGCTACATCTGGG - Intergenic
986177805 5:5366704-5366726 TCCTTAGTTCAGCTGAAAACGGG + Intergenic
986213331 5:5694786-5694808 TCCTTAGTTCATCTAAGAGCTGG - Intergenic
986213892 5:5699671-5699693 TCCTTATTTCAGCTAAGAGCTGG - Intergenic
986352310 5:6891812-6891834 TCCTCAGTTCAACTAAAAGCTGG - Intergenic
986539024 5:8824989-8825011 TCTTTAGTTCAGCTAAACAGGGG + Intergenic
987082094 5:14435104-14435126 TCCTTAGTTCAGCTAAAGACAGG + Intronic
987155091 5:15081346-15081368 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
987322051 5:16779076-16779098 TCCTTTGTTCAGCTAAAACCTGG - Intronic
987358355 5:17084501-17084523 TCCTTAGTTAAGCTAAAATCGGG + Intronic
987568632 5:19626008-19626030 TCCTTAGTTCAGCTAAAGACAGG - Intronic
987889968 5:23864220-23864242 CCCTTAGTTCTGCTAAAGATGGG - Intergenic
987910788 5:24141334-24141356 TCCTTAGTTCAGCTAAAGACTGG - Intronic
987935981 5:24465266-24465288 TCCTTAATTCAGCTAAATTTGGG - Intergenic
987994828 5:25263445-25263467 TCCTTAGTTCAGCTAAAAGTGGG + Intergenic
988054799 5:26080932-26080954 TCCTTAGTTCAGCTGAAGACGGG + Intergenic
988069870 5:26274047-26274069 TCCTTTGTTCAGCTAAATCCAGG - Intergenic
988157342 5:27472449-27472471 TCCTTAGTTCAGCTAATACCTGG - Intergenic
988585934 5:32507617-32507639 TCCTTAGTTCAGCTAAAACTGGG + Intergenic
988899494 5:35717503-35717525 TCCTTAGTTCAGCTAAAGACGGG + Intronic
988900154 5:35722918-35722940 TCCTTAGTTCAGCTAAAATGGGG + Intronic
989187987 5:38643283-38643305 TCCTCAGTTCAGCTAAAAACTGG + Intergenic
989691635 5:44152018-44152040 TCCTTAGTTCAGCTAAAACAGGG - Intergenic
989692401 5:44159596-44159618 TCTTTAGTTCAGCTAAAATCAGG - Intergenic
990444866 5:55885294-55885316 TCCTTAGTTCAGCTAAATCCGGG + Intronic
990548581 5:56849378-56849400 TCCTTTGTTGTGCTAAAGAGAGG + Intronic
990569953 5:57068062-57068084 TCCTTAGCTCAGCTAAACCCAGG - Intergenic
990777139 5:59315203-59315225 TCCTCAGTTCAGCTAAATCCAGG - Intronic
991014474 5:61916123-61916145 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
991465386 5:66907035-66907057 TCCTTAGTTCAACTAAAACTCGG + Intronic
991605661 5:68398021-68398043 TAGTTAGTTGAGCTTAAGACAGG + Intergenic
992442695 5:76810865-76810887 TCTTTAGTTCAGCTAAAGACAGG + Intergenic
994063564 5:95509250-95509272 TCCTTAGTTCAGCTAAAACCGGG + Intronic
994360830 5:98846481-98846503 TCCTTAGTTCAGCTAAAATCTGG + Intergenic
994453946 5:99981413-99981435 TCCTTAGTTCAGCTAAATCCAGG - Intergenic
994505923 5:100642435-100642457 TCCTTAGTCCAGCTAAAGACAGG - Intergenic
994852641 5:105075584-105075606 TCCTTAGTTCAGCTAGAAACCGG + Intergenic
994913112 5:105938952-105938974 TCCTTAGTTCATCTGAAAGCTGG + Intergenic
994979502 5:106855316-106855338 TCCTTAGCTCAGTTAAATCCGGG - Intergenic
995260958 5:110104022-110104044 TCCTTAGTTCAGCTAAGAGCCGG + Intergenic
995393360 5:111663054-111663076 TCTTTAGTTCAGCTAAAGACAGG + Intronic
995393846 5:111666804-111666826 TCCTTAGTTCAGCTAAAGATGGG + Intronic
995635518 5:114185670-114185692 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
995829843 5:116343846-116343868 TCCTTAGTTCAGCTAAAGACGGG + Intronic
995830402 5:116348586-116348608 TCCTTAGTTCACCTAAAGAGGGG + Intronic
996278127 5:121693736-121693758 TCCTTATTTCAGCTGAAAATAGG + Intergenic
996553871 5:124757955-124757977 TCCTTGGTTCAGCTAACAACAGG - Intergenic
996661550 5:126009327-126009349 TCCTTAGTTCAGCTAAAAACAGG - Intergenic
996665103 5:126049886-126049908 TCCTTAGTTCAGCTAAAGATAGG - Intergenic
996670216 5:126108874-126108896 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
996709064 5:126525986-126526008 TCCTTAGTTCAGCTAACAACGGG - Intergenic
996834061 5:127771767-127771789 TCCTTAGTTCAGCTAAAGATAGG + Intergenic
997082733 5:130759464-130759486 TCCTTTGTTCAGCTAAAAGCCGG - Intergenic
998641144 5:144012795-144012817 TCCTTAGTTCAGCTAAAACCAGG + Intergenic
998651087 5:144122570-144122592 TCCTTAGTTCAGCTAAAACCGGG + Intergenic
998741309 5:145205168-145205190 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
998942987 5:147305137-147305159 TCCTTAGGTCAGCTAAAACTGGG + Intronic
999008366 5:148006625-148006647 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
999534183 5:152499465-152499487 TCCTTAGTTCAGCTAAAGGCTGG + Intergenic
999553646 5:152717760-152717782 TCCTTAGTTTAGCTAAAGATGGG - Intergenic
999897566 5:156051955-156051977 TCCTTAGTTCAGCTAAAGACAGG + Intronic
1000022745 5:157332906-157332928 TTCTCAGTTCAGCTAAAGATGGG + Intronic
1000241844 5:159415961-159415983 TCCTTAGTTCAACTAAAACCGGG - Intergenic
1000643586 5:163735049-163735071 TCCTTAATTCAGCTAAAGATGGG + Intergenic
1000675650 5:164119737-164119759 TCCTTTGTTCAGCTAAAACTAGG + Intergenic
1001915205 5:175554789-175554811 TCCTTAGTTCAGCTAAAAACGGG + Intergenic
1002474372 5:179455743-179455765 TCCTTAGTTTAGCTAAAGACGGG + Intergenic
1003196499 6:3919763-3919785 TTCTTAGTTCAGCTAAAGACAGG + Intergenic
1003904028 6:10682205-10682227 TCCTTAGTTCAGCTAAATCTGGG - Intronic
1004485279 6:16060505-16060527 TCCTCAGCTCAGCTAAAGATGGG - Intergenic
1005033331 6:21531864-21531886 GCCTTAGGTCTCCTAAAGACTGG - Intergenic
1005042098 6:21609089-21609111 TCCTTGGTTCAGCTGAATACAGG - Intergenic
1005309748 6:24548200-24548222 TCCTTAGTTCAGCTAAAACCAGG + Intronic
1005564684 6:27079029-27079051 TCCTTAGTTCAGCTAAAAACCGG - Intergenic
1005577986 6:27208037-27208059 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1005787917 6:29264963-29264985 TCCTTAGTTCAGCTAAAAAGGGG - Intergenic
1005964804 6:30719864-30719886 TGCTTAGTTCAGCGAAAAATGGG - Intergenic
1005981537 6:30840596-30840618 TCCTCAGTTCAGCTAAAACCGGG + Intergenic
1006017218 6:31091428-31091450 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1008149603 6:47934376-47934398 TTCGTAGTTCAGCTAAAGATGGG - Intronic
1008412568 6:51197523-51197545 TCCTTAGTTCAAACAAAGAATGG - Intergenic
1009395913 6:63200554-63200576 TCCTTGGTGCAGAAAAAGACTGG - Intergenic
1009603821 6:65838965-65838987 TCTGTAGTTCAGCTAAAGACAGG - Intergenic
1009632426 6:66215413-66215435 TCCTTAGCTCAGCTAAAATCTGG - Intergenic
1009840908 6:69073396-69073418 TCCTTAGTTCAGCTAAGAGCCGG + Intronic
1010368077 6:75075978-75076000 TCCGTAGCTCAGCTAAAGACAGG + Intergenic
1010453765 6:76031122-76031144 TCCTTAGTTCAGCTAAAATTGGG - Intronic
1010541284 6:77095014-77095036 TCCTTAGTTCAGCTAAAACAGGG - Intergenic
1010541796 6:77100341-77100363 TCCTTAGTTCAGCAAAAACCGGG - Intergenic
1010669695 6:78673790-78673812 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1010992084 6:82490487-82490509 TCCTTAGTTCAGCCAAATCTGGG - Intergenic
1011590488 6:88966109-88966131 TCCTTAGTTCAGCTAAGAGCTGG - Intergenic
1012308458 6:97689447-97689469 TCCTTAGTTCAGCTAAAGGCAGG - Intergenic
1012520752 6:100118494-100118516 TCCTTAGTTTGGCTAAAGACGGG + Intergenic
1012742762 6:103040903-103040925 ACCTTAGTTCAGCTAAAATCTGG + Intergenic
1013410192 6:109876955-109876977 TCCTAAGTTCAGCTAAAAACGGG - Intergenic
1013455446 6:110325641-110325663 TCCTTAGTTCAGGTAAAATGGGG + Intronic
1014274238 6:119368611-119368633 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
1014470503 6:121808708-121808730 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1014747629 6:125218807-125218829 TCCTTAGTTCAGCTAAAAACGGG + Intronic
1014956343 6:127621534-127621556 ACCTTAGTTCAGCTAAAATCTGG - Intergenic
1015012075 6:128361836-128361858 TCTTTAGTTCATCTAAATAAAGG + Intronic
1015043009 6:128744417-128744439 TCCTTAGTTCAGCTAAAGACAGG + Intergenic
1015167779 6:130218082-130218104 TCTTTAGTTCAGCTAAGAGCTGG + Intronic
1015176799 6:130318221-130318243 TCATTAGTACAGCTAAAGTCAGG + Intronic
1015267258 6:131301314-131301336 TCCTTAGTTCAACTAAAGATGGG - Intergenic
1015803126 6:137080731-137080753 TCCTTAGCTCAGCTAAAGACAGG + Intergenic
1015859157 6:137657102-137657124 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
1016117194 6:140301859-140301881 TCCTTAGTTCAGCTAAAACCAGG - Intergenic
1016161888 6:140893357-140893379 TCCTTAGTTCGGCTAAAGACAGG + Intergenic
1016187274 6:141212270-141212292 CCCTTAGTTCAGCTAAAGATGGG + Intergenic
1016277915 6:142377134-142377156 TTCTTAGTTCAGCTAGAACCCGG + Intronic
1016686265 6:146885817-146885839 TCCTTTGTTCAGCTAAAAATGGG + Intergenic
1016777332 6:147919038-147919060 TCCTTATTTCAGCTCAATTCTGG - Intergenic
1016864135 6:148748474-148748496 TCCTTACTTCTGCTAAAGACAGG - Intronic
1017119819 6:151013767-151013789 TCCTTATTTCAGGTAACGGCTGG + Exonic
1017343413 6:153353106-153353128 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1017343977 6:153357839-153357861 TCCTGAGCTTAGCTAAAGATGGG - Intergenic
1017361662 6:153579612-153579634 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1017377483 6:153787645-153787667 TCCTTAGTTCAGCTGAAGACAGG - Intergenic
1017559281 6:155609679-155609701 TTCTTAGTTCAGCTAAATCCAGG + Intergenic
1017559980 6:155616137-155616159 TCCTTAGTTCAGCCAAATCTGGG + Intergenic
1018239665 6:161760699-161760721 TCCTTAGTTCAGCCATGGACGGG - Intronic
1018259384 6:161954264-161954286 TCATCAGTTCCACTAAAGACTGG + Intronic
1018359630 6:163054551-163054573 TCCTTAGTTCGGCTGAAGACAGG + Intronic
1020676698 7:11192249-11192271 TCCTTAGTTCAGCCAAAGTCGGG - Intergenic
1020677375 7:11197791-11197813 TCCTTAGTTCCGCTAAAGACGGG - Intergenic
1020904871 7:14052565-14052587 TCCTTAGTTCAGCTAAGAGATGG + Intergenic
1020956533 7:14745838-14745860 TCCTTAGTTCAGCTAAATCCAGG - Intronic
1021055047 7:16036493-16036515 TCCTTAGTTCAGCTAAAGGCAGG - Intergenic
1021101199 7:16586966-16586988 TCCTTAGTTCAGCTAAATCCAGG + Intergenic
1021169362 7:17379699-17379721 TACCTAGTTCAGCTAAAAATGGG - Intergenic
1021331003 7:19339467-19339489 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1021456498 7:20835115-20835137 TGCTTAGTTCAGCTAAAGACAGG + Intergenic
1021597950 7:22336866-22336888 TCCTTAGCTCAGCTAAAGATGGG - Intronic
1021647675 7:22802327-22802349 TCCTTAGTTTAGCTAAATCCAGG - Intergenic
1022315459 7:29241194-29241216 TTCTTAGTTCAGTCAGAGACGGG + Intronic
1022322054 7:29297022-29297044 TTCTTAGTTCAGGTAAAGACAGG + Intronic
1023367371 7:39477151-39477173 ACTTTACTTCAGCTGAAGACTGG + Intronic
1023488960 7:40717210-40717232 TCCTTAGTTCAGCTAAAAGCAGG + Intronic
1023682901 7:42706273-42706295 TCCTTAGTTCAGCTAAAGACTGG + Intergenic
1023719426 7:43077734-43077756 TTTTTAGTTCAGCTAAAGACAGG + Intergenic
1023970961 7:44990663-44990685 TTCTTAGTTCAGCTAAAATCTGG + Intergenic
1024112593 7:46162310-46162332 TCCTTAGCTCAATTAAAGACAGG + Intergenic
1024655489 7:51448205-51448227 TCCTTAGTTCAGTTAAATATAGG - Intergenic
1025983842 7:66430195-66430217 TCCTTAGTTCAGCTAAGGACGGG + Intergenic
1026031134 7:66795293-66795315 TCCTTAGTTCAGCTAAAGACGGG - Intronic
1027207048 7:76108944-76108966 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1027662632 7:81005614-81005636 TCCTTTGTTCAGCAAAAGACGGG - Intergenic
1028075766 7:86513413-86513435 TTCCTAGTCTAGCTAAAGACAGG + Intergenic
1028235886 7:88361198-88361220 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1028524398 7:91767798-91767820 TCCTTAGATCAGCTAAAGACTGG + Intronic
1028738351 7:94243697-94243719 TCCTTAGTTCAGTTAAAGACGGG - Intergenic
1028756459 7:94440695-94440717 TCCTTAGTTTAGCTAATGACAGG + Intergenic
1028861763 7:95659348-95659370 TCCTTAGTTTAGCTAAAGACTGG - Intergenic
1030245970 7:107384605-107384627 TCCTTAGTTCAGCTAACGATGGG - Intronic
1031021006 7:116627274-116627296 TCCTTAGTTGAGCTAAAGATGGG - Intergenic
1031534166 7:122913569-122913591 CCCTTAGTTCAGCTAAATCTGGG + Intergenic
1031834646 7:126668288-126668310 TCCTTAGTTCAGCTAGCGATGGG - Intronic
1031835227 7:126673301-126673323 CCCTTAGTTCAACTAAAGACAGG - Intronic
1032250917 7:130256566-130256588 TTCTTAGTTCAGCTAAAACCAGG - Intergenic
1032754488 7:134875693-134875715 TCCTTAGTTCAGCTAAAGACAGG - Intronic
1033464328 7:141577442-141577464 TCCTAAGTTCAGCTAAAGACAGG + Intronic
1034125974 7:148671962-148671984 TCCTTAGTTCAGCTAAAATCTGG + Intergenic
1035924932 8:3717486-3717508 CCCTTAGTTCAGCTAAAAACAGG + Intronic
1036084535 8:5599389-5599411 TCATTAGTTCAGCTAAAGACGGG + Intergenic
1036744302 8:11393133-11393155 TCCGTCGTTCAGCTAAAGCTTGG + Intronic
1038370301 8:26982166-26982188 TACTCAGTTCAGCTAAAATCCGG - Intergenic
1038405615 8:27320286-27320308 TCCTTAGTTTAGCTAAAGACGGG - Intronic
1038433069 8:27515282-27515304 TCCTTAGTTCAGCTGAAGACGGG - Intronic
1038864982 8:31429858-31429880 TCCTTAGTTCAGCTAAGAGCCGG - Intergenic
1039125488 8:34196944-34196966 TCCTTAGTTCAGCTAAAACTGGG + Intergenic
1039308700 8:36292763-36292785 TCCTTAGTTTGGCTAAAACCAGG - Intergenic
1039352608 8:36779452-36779474 TCCTTAGTTCGGCTAAAGACGGG - Intergenic
1039391692 8:37185976-37185998 TCCTTAGTTCAGCTAAAAATGGG - Intergenic
1039757643 8:40540410-40540432 TCTTTAGTTCAGCTAAAGATGGG - Intronic
1040374479 8:46810625-46810647 TCCTTAATTCAGCTAAAACCAGG + Intergenic
1040424572 8:47272704-47272726 TCCTTAGTTCAGCTAAAATCTGG + Intronic
1040662962 8:49596766-49596788 TCCTTAGTTCAGCTAAATCCAGG - Intergenic
1040664370 8:49615257-49615279 TCCTTAGTTCAGCTAAAAACAGG + Intergenic
1040949740 8:52925281-52925303 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1040997257 8:53414245-53414267 TTCTTAGGTCAGCTAAAACCAGG + Intergenic
1041142338 8:54835899-54835921 TGCTTAGTTCAGATAAGTACAGG - Intergenic
1041146850 8:54885206-54885228 TCCCTAGTTCCGCTAAAGATGGG + Intergenic
1041351630 8:56952819-56952841 TCCTTAGTTCAGCTAAATCCAGG - Intergenic
1041591948 8:59598013-59598035 TCCTTAGTTCACCTAAAACTGGG + Intergenic
1041597657 8:59675892-59675914 TGCTGATTTCAGCTACAGACAGG + Intergenic
1041996954 8:64074133-64074155 TACTTTGTTCATTTAAAGACAGG - Intergenic
1042442283 8:68842570-68842592 TCCTTAGTTCAGCTAAATCCAGG + Intergenic
1042514930 8:69649094-69649116 TCCTTTTTTGAGCTGAAGACAGG + Intronic
1043983097 8:86662874-86662896 TCCTTAGTTCAGCTAAAGACAGG - Intronic
1044517571 8:93156887-93156909 TCTTTAGTTCAGCTAAAATCTGG - Intronic
1045191543 8:99889082-99889104 TCCTTAGTTTAGCTAAATTTGGG - Intronic
1045201758 8:99990473-99990495 TCCTTCGTTCAGCTAAAGACTGG - Intronic
1046067167 8:109211072-109211094 TCCTTAGCTCAGCTAAAGACGGG - Intergenic
1046412152 8:113859474-113859496 TCCTTAGTTCAGCTAAAATCTGG - Intergenic
1046508912 8:115173243-115173265 TCCTTAGCTCAGCTAAAATCCGG - Intergenic
1047492224 8:125384482-125384504 TCCTTAGTTCAGCTAAGCGTTGG + Intergenic
1048649093 8:136454288-136454310 TCCTTAGTTCAGCTAAGAGCCGG - Intergenic
1048682007 8:136853615-136853637 TCCTTAGTTCAGCTAAAGGCGGG + Intergenic
1050134784 9:2450611-2450633 TCCTTAGTTCAGCTAAAGATAGG - Intergenic
1050445775 9:5721270-5721292 TCCTTAGTTTAGCTAAAAGCAGG + Intronic
1050510047 9:6384712-6384734 TCCTTAGTTCAGCTAAGGATGGG + Intergenic
1050785278 9:9393156-9393178 TTCTCAGTTCAGCTAAAACCAGG - Intronic
1050929859 9:11309020-11309042 TTCTTAGTTAAGCTAAAAACGGG - Intergenic
1051251389 9:15162196-15162218 TCCTTAGTTCTGTTAAAAGCCGG - Intergenic
1052059235 9:23940979-23941001 TCCTTAGTTCAGCTAAAATCTGG + Intergenic
1052230557 9:26145903-26145925 TCCTTAGTTCATCTAAAGATGGG + Intergenic
1052421984 9:28254091-28254113 TCCTTAGTTCAGCTAAAGACGGG - Intronic
1052509029 9:29390730-29390752 TCCTTATTTCAGCTATAAAGTGG + Intergenic
1052616700 9:30851437-30851459 TTCTTGGTTCAACTAAAGACAGG - Intergenic
1052617205 9:30855749-30855771 TCCTTAGTTCAGCTAAAGACAGG - Intergenic
1052693603 9:31848838-31848860 TCCTTAGTTCCGTTAAAGACGGG - Intergenic
1052875620 9:33560128-33560150 TCCTTAGTTCAGCTAAATCTGGG + Intronic
1053500392 9:38584216-38584238 TCCTTAGTTCAGCCAAATCTGGG - Intergenic
1053911105 9:42905013-42905035 TCCTTAGTTCAGCTCAATCTGGG + Intergenic
1054361736 9:64128571-64128593 TCCTTAGTTCAGCTACACCTGGG + Intergenic
1054372851 9:64421884-64421906 TCCTTAGTTCAGCTCAATCTGGG + Intergenic
1054680478 9:67911661-67911683 TCCTTAGTTCAGCTCAATCTGGG + Intergenic
1055569420 9:77601287-77601309 TCCTTAGTTCAGCTAAATCTCGG - Intronic
1055686196 9:78777744-78777766 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1056035041 9:82595478-82595500 TCCCTAGTTCAGCAAAATAAAGG - Intergenic
1056350546 9:85744458-85744480 TCCTTAGCTCAGCTAGATCCAGG + Intergenic
1056520399 9:87395780-87395802 TCCTTAGTTCAGCTAAAAACAGG - Intergenic
1056889847 9:90480947-90480969 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
1056935289 9:90911505-90911527 TCCTTAGTTCAGCTAAAGACTGG - Intergenic
1057174747 9:92988035-92988057 TCCTTAGTTCAGCTAAAATCCGG + Intronic
1057457977 9:95231628-95231650 TCCCTAGTTCAGCTAAGGACGGG - Intronic
1057679788 9:97168642-97168664 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
1058207253 9:102124425-102124447 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1058731686 9:107856611-107856633 TCCTTAGCTCAGCTAAAGATGGG + Intergenic
1059190944 9:112325529-112325551 TTCTTAGTTCAACTAAATCCAGG - Intronic
1059223119 9:112644632-112644654 TAATTACTTCAGATAAAGACAGG - Intronic
1059298174 9:113291086-113291108 TGCTCAGTTAAGCTAAAGCCTGG - Intronic
1059811053 9:117856139-117856161 TCCTTAGTTCAGCTAAAAATGGG + Intergenic
1062666666 9:137676987-137677009 TCCTTAGTTCAGCTAAAATCCGG - Intronic
1203692622 Un_GL000214v1:59553-59575 TCCTTAGTTCAGCTACATCTGGG - Intergenic
1203556807 Un_KI270744v1:6445-6467 TCCTTAGTTCAGCTACATCTGGG - Intergenic
1203643673 Un_KI270751v1:44638-44660 TCCTTAGTTCAGCTACATCTGGG + Intergenic
1185940097 X:4308168-4308190 TCCGTTGTTCAGCTAAAGGCGGG - Intergenic
1186056060 X:5650826-5650848 TCCTCAGTTCAGCTAAAGATGGG - Intergenic
1186099032 X:6135365-6135387 TCCTTTTTTCAGCTAAAAAGAGG - Intronic
1186825913 X:13340028-13340050 TCCTTAGTTCAGCTGAAGACGGG + Intergenic
1186939456 X:14489376-14489398 TCCTTAATTCAGCTAAAGATGGG + Intergenic
1187842894 X:23506971-23506993 TCCTTAGTTCAGCTCACACCGGG - Intergenic
1188126331 X:26373766-26373788 TCCTTAGTTCAGGTAAACCTGGG + Intergenic
1188179284 X:27034345-27034367 TCCTTAGTTCGGCTAAGTTCCGG + Intergenic
1188212219 X:27440291-27440313 TCCTTAGTTCAGCTAAATCTGGG + Intergenic
1188212849 X:27444366-27444388 TCCTTAGTTCAGCTAAATCTGGG + Intergenic
1188518161 X:31009729-31009751 TTCCTAGTTCAGCTAAATTCGGG - Intergenic
1188762858 X:34053966-34053988 TCCTTTGTTCAGCTAAGAGCTGG - Intergenic
1188869954 X:35360509-35360531 TCCTTAGTCCAGCTAAAGATGGG - Intergenic
1189152897 X:38726077-38726099 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1189415619 X:40810107-40810129 TCCTTAGTTCAGCTAAAACCAGG - Intergenic
1189459578 X:41228345-41228367 TAGTTAGTTCAGGGAAAGACAGG + Intronic
1189621521 X:42845649-42845671 TCCTTAGTTCAGCTGATGACGGG + Intergenic
1189649803 X:43177133-43177155 TCCTTAGTTCAGCTAAAATCAGG - Intergenic
1189947769 X:46196494-46196516 TCCTTAGTTCAGCTAAATGCAGG - Intergenic
1190491252 X:50984252-50984274 TCCTTATTTCAGCTAAAGATGGG - Intergenic
1190576767 X:51847455-51847477 TCCTTAGTTCAGCTAGAACTGGG + Intronic
1191189450 X:57650962-57650984 TCCTTAGTTTAGCTAAACCCAGG - Intergenic
1191190009 X:57656507-57656529 TGCTTAGTTCAGCTAAATTGAGG - Intergenic
1191638169 X:63400763-63400785 TCTTTAGTTCAGCTAAAACTGGG - Intergenic
1191645050 X:63471021-63471043 TCTTTAGTTCAGCTAAAAGCTGG + Intergenic
1191910588 X:66144888-66144910 TCCTCAGTTCACCTAAAGACAGG - Intergenic
1192295503 X:69843658-69843680 TACTTACTTCATATAAAGACAGG + Intronic
1192595855 X:72407520-72407542 TCCTTAGTTCAGCTAAAGATGGG - Intronic
1192680987 X:73253978-73254000 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1193254391 X:79330032-79330054 TCCTTAGTTCAGCTAAAGACGGG + Intergenic
1193269879 X:79516277-79516299 TCCTTAGTTAAGCTAAAACTGGG - Intergenic
1193481855 X:82036528-82036550 CCCTTAGTTCAGCTAAAACGGGG - Intergenic
1193699971 X:84748255-84748277 TCCTTAGTTCAGCTAAAACCGGG - Intergenic
1194059227 X:89177232-89177254 TCCTTAGCTCACCTAAATCCGGG + Intergenic
1194066863 X:89271543-89271565 TCCTTAGTTCAGGTAAAGATGGG + Intergenic
1194086971 X:89539555-89539577 TCCTTAGTTGAGCTCAAGACTGG - Intergenic
1194403089 X:93461863-93461885 TCCTTAGTCCAGCTAAAGGCAGG + Intergenic
1194662503 X:96642673-96642695 TCCTCAGTTCAGTTAAAAACTGG + Intergenic
1195245651 X:102992792-102992814 TCCTTAGTTCAGCTAAAAACGGG - Intergenic
1196510372 X:116503189-116503211 TACTTAGAGCAGCTAAAGAATGG + Intergenic
1196520146 X:116662933-116662955 TCCTTAGTTCAGCTAAAGATGGG + Intergenic
1196652158 X:118178855-118178877 TCCTTAGTTCAGCTAAAACTGGG - Intergenic
1197066507 X:122239260-122239282 TCCTTAGTTCAGCTAAATCTGGG - Intergenic
1197066703 X:122241921-122241943 TCCTTAGTTCAGTTAAATATGGG + Intergenic
1197283359 X:124564542-124564564 CCCATTGTTCAGCTAAAGAAAGG - Intronic
1197299459 X:124760283-124760305 TCTTTAGTTCAGCTAAAATCAGG - Intronic
1197348721 X:125356988-125357010 TCCTTAGTTCAGCTAAGAGCTGG - Intergenic
1197365636 X:125562160-125562182 TCCTTAATTCAGCTAAAGTTGGG + Intergenic
1197366223 X:125567425-125567447 TCTTCAGTTCAGCTAAAGATGGG + Intergenic
1197388309 X:125827425-125827447 TCCTTAGTTCAGCTAAAGACGGG - Intergenic
1197425648 X:126294778-126294800 TCCTTAGTTCAGCTAAAGGTGGG + Intergenic
1197435354 X:126421064-126421086 TCCTTAGATCAGCTAAGTCCGGG - Intergenic
1197492260 X:127132160-127132182 CCCTTAGTTTGGCTAAAGATTGG - Intergenic
1197579996 X:128270341-128270363 TCCTGTCATCAGCTAAAGACTGG + Intergenic
1197662970 X:129193773-129193795 TCCTTGGTTCAGCTAAAGGGAGG - Intergenic
1197971305 X:132118312-132118334 TCCTTAGTTCAGCTAAAACCAGG + Intronic
1198074996 X:133185515-133185537 TCCTTAGTTCAGCTAAAGATGGG - Intergenic
1198133965 X:133728229-133728251 TTCTCAGATCAGCTAAAGATTGG + Intronic
1198498711 X:137220673-137220695 TCCTTAGTACAGCTAAAAACGGG - Intergenic
1198647347 X:138823552-138823574 TCCTTAGCTCAGCTACAGATAGG - Intronic
1198850603 X:140961933-140961955 TCCTTGGTTCAGCTAAAACCTGG - Intergenic
1199043314 X:143139837-143139859 TCTTTAGTTCTGCTAAAACCTGG + Intergenic
1199053882 X:143269640-143269662 TCTTTAGTTAGGCTAAAGAAAGG - Intergenic
1199058985 X:143330604-143330626 TCCTTAGCTCAGCTAAAGACAGG - Intergenic
1199234329 X:145472698-145472720 TCCTTGGTTCAGCTAAAGATAGG - Intergenic
1199430112 X:147749149-147749171 TCCTTAGTCGAGCTAAACACGGG + Intergenic
1200258344 X:154597818-154597840 TGCTCAGTTCAGCTAAAAACTGG - Intergenic
1200416495 Y:2916905-2916927 TCATTAGTTCAGCTAAAGACTGG - Intronic
1200416741 Y:2919672-2919694 TCATTAGTTCAGCTAAAGACTGG - Intronic
1200439625 Y:3195424-3195446 TCCTTAGTTGAGCTCAAGACTGG - Intergenic
1200721028 Y:6605702-6605724 TCCTTAGTTCAGGTAAAGATGGG + Intergenic
1200871522 Y:8104422-8104444 TCCTTAGTTAAGCTAAAACAAGG - Intergenic
1201526330 Y:14938578-14938600 TCCTTAGTTCATCTAAAAACAGG - Intergenic
1202244499 Y:22805066-22805088 TCCTTAGTTAAGCTAAAACAAGG + Intergenic
1202397488 Y:24438812-24438834 TCCTTAGTTAAGCTAAAACAAGG + Intergenic
1202473293 Y:25231275-25231297 TCCTTAGTTAAGCTAAAACAAGG - Intergenic