ID: 984432542

View in Genome Browser
Species Human (GRCh38)
Location 4:179666642-179666664
Sequence GCAACAATGATACACCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984432540_984432542 8 Left 984432540 4:179666611-179666633 CCTGTCTTTAGCTGAACTAAGGA 0: 66
1: 150
2: 203
3: 202
4: 219
Right 984432542 4:179666642-179666664 GCAACAATGATACACCTTAAAGG No data
984432538_984432542 9 Left 984432538 4:179666610-179666632 CCCTGTCTTTAGCTGAACTAAGG 0: 32
1: 85
2: 132
3: 176
4: 236
Right 984432542 4:179666642-179666664 GCAACAATGATACACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984432542 Original CRISPR GCAACAATGATACACCTTAA AGG Intergenic
No off target data available for this crispr