ID: 984434284

View in Genome Browser
Species Human (GRCh38)
Location 4:179688722-179688744
Sequence AAATAAGCTCATATTAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984434284_984434286 15 Left 984434284 4:179688722-179688744 CCAAAACTAATATGAGCTTATTT No data
Right 984434286 4:179688760-179688782 TCTTTAGCCAGAAAATCAGGAGG No data
984434284_984434287 16 Left 984434284 4:179688722-179688744 CCAAAACTAATATGAGCTTATTT No data
Right 984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG No data
984434284_984434285 12 Left 984434284 4:179688722-179688744 CCAAAACTAATATGAGCTTATTT No data
Right 984434285 4:179688757-179688779 TGTTCTTTAGCCAGAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984434284 Original CRISPR AAATAAGCTCATATTAGTTT TGG (reversed) Intergenic