ID: 984434285

View in Genome Browser
Species Human (GRCh38)
Location 4:179688757-179688779
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984434284_984434285 12 Left 984434284 4:179688722-179688744 CCAAAACTAATATGAGCTTATTT No data
Right 984434285 4:179688757-179688779 TGTTCTTTAGCCAGAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type