ID: 984434286

View in Genome Browser
Species Human (GRCh38)
Location 4:179688760-179688782
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984434284_984434286 15 Left 984434284 4:179688722-179688744 CCAAAACTAATATGAGCTTATTT No data
Right 984434286 4:179688760-179688782 TCTTTAGCCAGAAAATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type