ID: 984434287

View in Genome Browser
Species Human (GRCh38)
Location 4:179688761-179688783
Sequence CTTTAGCCAGAAAATCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984434284_984434287 16 Left 984434284 4:179688722-179688744 CCAAAACTAATATGAGCTTATTT No data
Right 984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984434287 Original CRISPR CTTTAGCCAGAAAATCAGGA GGG Intergenic
No off target data available for this crispr