ID: 984434979

View in Genome Browser
Species Human (GRCh38)
Location 4:179698134-179698156
Sequence TTGGAACCACTTATGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984434979_984434981 20 Left 984434979 4:179698134-179698156 CCTTTCTTCATAAGTGGTTCCAA No data
Right 984434981 4:179698177-179698199 TTTACAACTCTGAAATATTGAGG No data
984434979_984434982 21 Left 984434979 4:179698134-179698156 CCTTTCTTCATAAGTGGTTCCAA No data
Right 984434982 4:179698178-179698200 TTACAACTCTGAAATATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984434979 Original CRISPR TTGGAACCACTTATGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr