ID: 984443708

View in Genome Browser
Species Human (GRCh38)
Location 4:179806201-179806223
Sequence ATACTGTTTCCCATAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984443708_984443712 -3 Left 984443708 4:179806201-179806223 CCCAAATCTATGGGAAACAGTAT No data
Right 984443712 4:179806221-179806243 TATAAGCAGAACTAAGAGGGAGG No data
984443708_984443710 -7 Left 984443708 4:179806201-179806223 CCCAAATCTATGGGAAACAGTAT No data
Right 984443710 4:179806217-179806239 ACAGTATAAGCAGAACTAAGAGG No data
984443708_984443711 -6 Left 984443708 4:179806201-179806223 CCCAAATCTATGGGAAACAGTAT No data
Right 984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984443708 Original CRISPR ATACTGTTTCCCATAGATTT GGG (reversed) Intergenic
No off target data available for this crispr