ID: 984443709

View in Genome Browser
Species Human (GRCh38)
Location 4:179806202-179806224
Sequence TATACTGTTTCCCATAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984443709_984443711 -7 Left 984443709 4:179806202-179806224 CCAAATCTATGGGAAACAGTATA No data
Right 984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG No data
984443709_984443710 -8 Left 984443709 4:179806202-179806224 CCAAATCTATGGGAAACAGTATA No data
Right 984443710 4:179806217-179806239 ACAGTATAAGCAGAACTAAGAGG No data
984443709_984443712 -4 Left 984443709 4:179806202-179806224 CCAAATCTATGGGAAACAGTATA No data
Right 984443712 4:179806221-179806243 TATAAGCAGAACTAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984443709 Original CRISPR TATACTGTTTCCCATAGATT TGG (reversed) Intergenic
No off target data available for this crispr