ID: 984443711

View in Genome Browser
Species Human (GRCh38)
Location 4:179806218-179806240
Sequence CAGTATAAGCAGAACTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984443707_984443711 -2 Left 984443707 4:179806197-179806219 CCTACCCAAATCTATGGGAAACA No data
Right 984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG No data
984443708_984443711 -6 Left 984443708 4:179806201-179806223 CCCAAATCTATGGGAAACAGTAT No data
Right 984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG No data
984443709_984443711 -7 Left 984443709 4:179806202-179806224 CCAAATCTATGGGAAACAGTATA No data
Right 984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984443711 Original CRISPR CAGTATAAGCAGAACTAAGA GGG Intergenic
No off target data available for this crispr