ID: 984450963

View in Genome Browser
Species Human (GRCh38)
Location 4:179900891-179900913
Sequence CTGCCTGTACTGTAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984450963_984450966 23 Left 984450963 4:179900891-179900913 CCTTGCAGCTACAGTACAGGCAG No data
Right 984450966 4:179900937-179900959 GATACTCCTAAACCAGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984450963 Original CRISPR CTGCCTGTACTGTAGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr