ID: 984463675

View in Genome Browser
Species Human (GRCh38)
Location 4:180070240-180070262
Sequence TGGATCGGTATGCTATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984463670_984463675 12 Left 984463670 4:180070205-180070227 CCTTTAATGTATATGATAGAAGT No data
Right 984463675 4:180070240-180070262 TGGATCGGTATGCTATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984463675 Original CRISPR TGGATCGGTATGCTATAGAG AGG Intergenic
No off target data available for this crispr