ID: 984466252

View in Genome Browser
Species Human (GRCh38)
Location 4:180102196-180102218
Sequence GCTGCTTGTACTCAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984466251_984466252 -2 Left 984466251 4:180102175-180102197 CCATGAGCGCAGTGCACACTGGC No data
Right 984466252 4:180102196-180102218 GCTGCTTGTACTCAGCCATCTGG No data
984466249_984466252 12 Left 984466249 4:180102161-180102183 CCTCTTTCTCTTTTCCATGAGCG No data
Right 984466252 4:180102196-180102218 GCTGCTTGTACTCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984466252 Original CRISPR GCTGCTTGTACTCAGCCATC TGG Intergenic
No off target data available for this crispr