ID: 984467132

View in Genome Browser
Species Human (GRCh38)
Location 4:180114339-180114361
Sequence GTTCTTCTTCCCACTGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984467132_984467136 4 Left 984467132 4:180114339-180114361 CCTGATGCAGTGGGAAGAAGAAC No data
Right 984467136 4:180114366-180114388 TGAGGGAATAAACAGTTTGGAGG No data
984467132_984467135 1 Left 984467132 4:180114339-180114361 CCTGATGCAGTGGGAAGAAGAAC No data
Right 984467135 4:180114363-180114385 CTTTGAGGGAATAAACAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984467132 Original CRISPR GTTCTTCTTCCCACTGCATC AGG (reversed) Intergenic
No off target data available for this crispr