ID: 984471244

View in Genome Browser
Species Human (GRCh38)
Location 4:180177147-180177169
Sequence AGATTCTGGTATGTTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984471244_984471246 0 Left 984471244 4:180177147-180177169 CCTGTTTCAACATACCAGAATCT No data
Right 984471246 4:180177170-180177192 CTTCCTGTTCTCAATACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984471244 Original CRISPR AGATTCTGGTATGTTGAAAC AGG (reversed) Intergenic
No off target data available for this crispr