ID: 984471609

View in Genome Browser
Species Human (GRCh38)
Location 4:180182829-180182851
Sequence GGGAATCGCTGGAACCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984471603_984471609 2 Left 984471603 4:180182804-180182826 CCAGCTACTCAGGAGGAAGAGGC No data
Right 984471609 4:180182829-180182851 GGGAATCGCTGGAACCTAGGAGG No data
984471601_984471609 3 Left 984471601 4:180182803-180182825 CCCAGCTACTCAGGAGGAAGAGG No data
Right 984471609 4:180182829-180182851 GGGAATCGCTGGAACCTAGGAGG No data
984471599_984471609 11 Left 984471599 4:180182795-180182817 CCTATAGTCCCAGCTACTCAGGA 0: 3705
1: 54567
2: 174550
3: 225301
4: 201127
Right 984471609 4:180182829-180182851 GGGAATCGCTGGAACCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984471609 Original CRISPR GGGAATCGCTGGAACCTAGG AGG Intergenic
No off target data available for this crispr