ID: 984471760

View in Genome Browser
Species Human (GRCh38)
Location 4:180184490-180184512
Sequence CTGAATTTGGTTGTGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984471751_984471760 26 Left 984471751 4:180184441-180184463 CCCCAGATTTTGAAATCATGTAT No data
Right 984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG No data
984471753_984471760 24 Left 984471753 4:180184443-180184465 CCAGATTTTGAAATCATGTATGC No data
Right 984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG No data
984471755_984471760 2 Left 984471755 4:180184465-180184487 CCTAAAGCAGGATAATTTAGTTT No data
Right 984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG No data
984471752_984471760 25 Left 984471752 4:180184442-180184464 CCCAGATTTTGAAATCATGTATG No data
Right 984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984471760 Original CRISPR CTGAATTTGGTTGTGGTGGT GGG Intergenic
No off target data available for this crispr