ID: 984477827

View in Genome Browser
Species Human (GRCh38)
Location 4:180259369-180259391
Sequence AATCATCTCAATAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984477817_984477827 1 Left 984477817 4:180259345-180259367 CCCATCTTTCTCATCCCCACTCC No data
Right 984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG No data
984477815_984477827 9 Left 984477815 4:180259337-180259359 CCCATTGGCCCATCTTTCTCATC No data
Right 984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG No data
984477816_984477827 8 Left 984477816 4:180259338-180259360 CCATTGGCCCATCTTTCTCATCC No data
Right 984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG No data
984477818_984477827 0 Left 984477818 4:180259346-180259368 CCATCTTTCTCATCCCCACTCCC No data
Right 984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984477827 Original CRISPR AATCATCTCAATAAGGAGGA GGG Intergenic
No off target data available for this crispr