ID: 984492129

View in Genome Browser
Species Human (GRCh38)
Location 4:180447749-180447771
Sequence ATTGCATTGATAGTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984492129_984492130 0 Left 984492129 4:180447749-180447771 CCAGCAGCAACTATCAATGCAAT No data
Right 984492130 4:180447772-180447794 TATGATCTATAGAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984492129 Original CRISPR ATTGCATTGATAGTTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr