ID: 984496283

View in Genome Browser
Species Human (GRCh38)
Location 4:180501678-180501700
Sequence AGGAAGAATGCAGTGATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984496283_984496285 -10 Left 984496283 4:180501678-180501700 CCAACTATCACTGCATTCTTCCT No data
Right 984496285 4:180501691-180501713 CATTCTTCCTGGATTAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984496283 Original CRISPR AGGAAGAATGCAGTGATAGT TGG (reversed) Intergenic
No off target data available for this crispr