ID: 984498728

View in Genome Browser
Species Human (GRCh38)
Location 4:180531960-180531982
Sequence GCTCAGGATTGAGAATCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498728_984498735 29 Left 984498728 4:180531960-180531982 CCCAGTGATTCTCAATCCTGAGC No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498728_984498732 17 Left 984498728 4:180531960-180531982 CCCAGTGATTCTCAATCCTGAGC No data
Right 984498732 4:180532000-180532022 TGCCCTCACTCAGCCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498728 Original CRISPR GCTCAGGATTGAGAATCACT GGG (reversed) Intergenic
No off target data available for this crispr