ID: 984498729

View in Genome Browser
Species Human (GRCh38)
Location 4:180531961-180531983
Sequence TGCTCAGGATTGAGAATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498729_984498735 28 Left 984498729 4:180531961-180531983 CCAGTGATTCTCAATCCTGAGCA No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498729_984498732 16 Left 984498729 4:180531961-180531983 CCAGTGATTCTCAATCCTGAGCA No data
Right 984498732 4:180532000-180532022 TGCCCTCACTCAGCCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498729 Original CRISPR TGCTCAGGATTGAGAATCAC TGG (reversed) Intergenic
No off target data available for this crispr