ID: 984498730

View in Genome Browser
Species Human (GRCh38)
Location 4:180531976-180531998
Sequence GGCAGTGAGCGAAATTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498730_984498735 13 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498730_984498732 1 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498732 4:180532000-180532022 TGCCCTCACTCAGCCATTTCTGG No data
984498730_984498738 27 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426
984498730_984498739 30 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498739 4:180532029-180532051 TTTTGGTTTTCACAACTGGGTGG No data
984498730_984498737 26 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG 0: 11
1: 147
2: 460
3: 766
4: 1189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498730 Original CRISPR GGCAGTGAGCGAAATTGCTC AGG (reversed) Intergenic
No off target data available for this crispr