ID: 984498731

View in Genome Browser
Species Human (GRCh38)
Location 4:180531997-180532019
Sequence GAAATGGCTGAGTGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498731_984498740 10 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498740 4:180532030-180532052 TTTGGTTTTCACAACTGGGTGGG No data
984498731_984498739 9 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498739 4:180532029-180532051 TTTTGGTTTTCACAACTGGGTGG No data
984498731_984498742 12 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data
984498731_984498735 -8 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498731_984498741 11 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498741 4:180532031-180532053 TTGGTTTTCACAACTGGGTGGGG No data
984498731_984498738 6 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG No data
984498731_984498737 5 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498731 Original CRISPR GAAATGGCTGAGTGAGGGCA AGG (reversed) Intergenic