ID: 984498733

View in Genome Browser
Species Human (GRCh38)
Location 4:180532002-180532024
Sequence CTCCAGAAATGGCTGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498733_984498743 27 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498743 4:180532052-180532074 GGGAGACACTGTCATTAAGTAGG No data
984498733_984498741 6 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498741 4:180532031-180532053 TTGGTTTTCACAACTGGGTGGGG No data
984498733_984498740 5 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498740 4:180532030-180532052 TTTGGTTTTCACAACTGGGTGGG No data
984498733_984498742 7 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data
984498733_984498739 4 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498739 4:180532029-180532051 TTTTGGTTTTCACAACTGGGTGG No data
984498733_984498737 0 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG No data
984498733_984498738 1 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498733 Original CRISPR CTCCAGAAATGGCTGAGTGA GGG (reversed) Intergenic