ID: 984498734

View in Genome Browser
Species Human (GRCh38)
Location 4:180532003-180532025
Sequence TCTCCAGAAATGGCTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498734_984498738 0 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426
984498734_984498737 -1 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG 0: 11
1: 147
2: 460
3: 766
4: 1189
984498734_984498743 26 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498743 4:180532052-180532074 GGGAGACACTGTCATTAAGTAGG No data
984498734_984498741 5 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498741 4:180532031-180532053 TTGGTTTTCACAACTGGGTGGGG No data
984498734_984498739 3 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498739 4:180532029-180532051 TTTTGGTTTTCACAACTGGGTGG No data
984498734_984498740 4 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498740 4:180532030-180532052 TTTGGTTTTCACAACTGGGTGGG No data
984498734_984498742 6 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498734 Original CRISPR TCTCCAGAAATGGCTGAGTG AGG (reversed) Intergenic
No off target data available for this crispr