ID: 984498735

View in Genome Browser
Species Human (GRCh38)
Location 4:180532012-180532034
Sequence GCCATTTCTGGAGACATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498730_984498735 13 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498731_984498735 -8 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498728_984498735 29 Left 984498728 4:180531960-180531982 CCCAGTGATTCTCAATCCTGAGC No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data
984498729_984498735 28 Left 984498729 4:180531961-180531983 CCAGTGATTCTCAATCCTGAGCA No data
Right 984498735 4:180532012-180532034 GCCATTTCTGGAGACATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498735 Original CRISPR GCCATTTCTGGAGACATTTT TGG Intergenic
No off target data available for this crispr