ID: 984498736

View in Genome Browser
Species Human (GRCh38)
Location 4:180532013-180532035
Sequence ACCAAAAATGTCTCCAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498736_984498741 -5 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498741 4:180532031-180532053 TTGGTTTTCACAACTGGGTGGGG No data
984498736_984498740 -6 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498740 4:180532030-180532052 TTTGGTTTTCACAACTGGGTGGG No data
984498736_984498742 -4 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data
984498736_984498743 16 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498743 4:180532052-180532074 GGGAGACACTGTCATTAAGTAGG No data
984498736_984498739 -7 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498739 4:180532029-180532051 TTTTGGTTTTCACAACTGGGTGG No data
984498736_984498745 29 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498745 4:180532065-180532087 ATTAAGTAGGCAGAGGCAAGAGG No data
984498736_984498744 22 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498744 4:180532058-180532080 CACTGTCATTAAGTAGGCAGAGG No data
984498736_984498738 -10 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498736 Original CRISPR ACCAAAAATGTCTCCAGAAA TGG (reversed) Intergenic
No off target data available for this crispr