ID: 984498737

View in Genome Browser
Species Human (GRCh38)
Location 4:180532025-180532047
Sequence ACATTTTTGGTTTTCACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2573
Summary {0: 11, 1: 147, 2: 460, 3: 766, 4: 1189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498731_984498737 5 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG 0: 11
1: 147
2: 460
3: 766
4: 1189
984498730_984498737 26 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG 0: 11
1: 147
2: 460
3: 766
4: 1189
984498733_984498737 0 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG 0: 11
1: 147
2: 460
3: 766
4: 1189
984498734_984498737 -1 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498737 4:180532025-180532047 ACATTTTTGGTTTTCACAACTGG 0: 11
1: 147
2: 460
3: 766
4: 1189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498737 Original CRISPR ACATTTTTGGTTTTCACAAC TGG Intergenic
Too many off-targets to display for this crispr