ID: 984498738

View in Genome Browser
Species Human (GRCh38)
Location 4:180532026-180532048
Sequence CATTTTTGGTTTTCACAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2976
Summary {0: 12, 1: 147, 2: 530, 3: 861, 4: 1426}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498730_984498738 27 Left 984498730 4:180531976-180531998 CCTGAGCAATTTCGCTCACTGCC No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426
984498731_984498738 6 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426
984498734_984498738 0 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426
984498736_984498738 -10 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426
984498733_984498738 1 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498738 4:180532026-180532048 CATTTTTGGTTTTCACAACTGGG 0: 12
1: 147
2: 530
3: 861
4: 1426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498738 Original CRISPR CATTTTTGGTTTTCACAACT GGG Intergenic
Too many off-targets to display for this crispr