ID: 984498742

View in Genome Browser
Species Human (GRCh38)
Location 4:180532032-180532054
Sequence TGGTTTTCACAACTGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498733_984498742 7 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data
984498734_984498742 6 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data
984498736_984498742 -4 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data
984498731_984498742 12 Left 984498731 4:180531997-180532019 CCTTGCCCTCACTCAGCCATTTC No data
Right 984498742 4:180532032-180532054 TGGTTTTCACAACTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498742 Original CRISPR TGGTTTTCACAACTGGGTGG GGG Intergenic
No off target data available for this crispr