ID: 984498743

View in Genome Browser
Species Human (GRCh38)
Location 4:180532052-180532074
Sequence GGGAGACACTGTCATTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498733_984498743 27 Left 984498733 4:180532002-180532024 CCCTCACTCAGCCATTTCTGGAG No data
Right 984498743 4:180532052-180532074 GGGAGACACTGTCATTAAGTAGG No data
984498734_984498743 26 Left 984498734 4:180532003-180532025 CCTCACTCAGCCATTTCTGGAGA No data
Right 984498743 4:180532052-180532074 GGGAGACACTGTCATTAAGTAGG No data
984498736_984498743 16 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498743 4:180532052-180532074 GGGAGACACTGTCATTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498743 Original CRISPR GGGAGACACTGTCATTAAGT AGG Intergenic
No off target data available for this crispr