ID: 984498744

View in Genome Browser
Species Human (GRCh38)
Location 4:180532058-180532080
Sequence CACTGTCATTAAGTAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498736_984498744 22 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498744 4:180532058-180532080 CACTGTCATTAAGTAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498744 Original CRISPR CACTGTCATTAAGTAGGCAG AGG Intergenic
No off target data available for this crispr