ID: 984498745

View in Genome Browser
Species Human (GRCh38)
Location 4:180532065-180532087
Sequence ATTAAGTAGGCAGAGGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984498736_984498745 29 Left 984498736 4:180532013-180532035 CCATTTCTGGAGACATTTTTGGT No data
Right 984498745 4:180532065-180532087 ATTAAGTAGGCAGAGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984498745 Original CRISPR ATTAAGTAGGCAGAGGCAAG AGG Intergenic
No off target data available for this crispr