ID: 984509781

View in Genome Browser
Species Human (GRCh38)
Location 4:180665587-180665609
Sequence ACATCATTCCTTAAGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984509781_984509783 11 Left 984509781 4:180665587-180665609 CCTAGTTTCTTAAGGAATGATGT No data
Right 984509783 4:180665621-180665643 TTCTTATATAGAGAAGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984509781 Original CRISPR ACATCATTCCTTAAGAAACT AGG (reversed) Intergenic
No off target data available for this crispr