ID: 984512358

View in Genome Browser
Species Human (GRCh38)
Location 4:180694017-180694039
Sequence CAAAATACTAATAGTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512358_984512360 5 Left 984512358 4:180694017-180694039 CCTATATCACTATTAGTATTTTG No data
Right 984512360 4:180694045-180694067 AGCCAATTCAACAAGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512358 Original CRISPR CAAAATACTAATAGTGATAT AGG (reversed) Intergenic
No off target data available for this crispr