ID: 984512411

View in Genome Browser
Species Human (GRCh38)
Location 4:180694486-180694508
Sequence ATGGATGGTAATTGAATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512411_984512416 0 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512416 4:180694509-180694531 TGGCTCCCTCTTACCACATGTGG No data
984512411_984512421 8 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data
984512411_984512422 9 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512411_984512417 1 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512417 4:180694510-180694532 GGCTCCCTCTTACCACATGTGGG No data
984512411_984512418 2 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512418 4:180694511-180694533 GCTCCCTCTTACCACATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512411 Original CRISPR ATGGATGGTAATTGAATCAT GGG (reversed) Intergenic