ID: 984512412

View in Genome Browser
Species Human (GRCh38)
Location 4:180694487-180694509
Sequence AATGGATGGTAATTGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512412_984512418 1 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512418 4:180694511-180694533 GCTCCCTCTTACCACATGTGGGG No data
984512412_984512416 -1 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512416 4:180694509-180694531 TGGCTCCCTCTTACCACATGTGG No data
984512412_984512422 8 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512412_984512417 0 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512417 4:180694510-180694532 GGCTCCCTCTTACCACATGTGGG No data
984512412_984512421 7 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512412 Original CRISPR AATGGATGGTAATTGAATCA TGG (reversed) Intergenic
No off target data available for this crispr